ID: 955445419

View in Genome Browser
Species Human (GRCh38)
Location 3:59004984-59005006
Sequence CAAAAGGTATGGATAGAGTA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 224
Summary {0: 1, 1: 0, 2: 2, 3: 20, 4: 201}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
955445419_955445424 8 Left 955445419 3:59004984-59005006 CCTTACTCTATCCATACCTTTTG 0: 1
1: 0
2: 2
3: 20
4: 201
Right 955445424 3:59005015-59005037 TTTTGTAATGCCTTCTCCTTGGG 0: 1
1: 0
2: 2
3: 24
4: 461
955445419_955445425 13 Left 955445419 3:59004984-59005006 CCTTACTCTATCCATACCTTTTG 0: 1
1: 0
2: 2
3: 20
4: 201
Right 955445425 3:59005020-59005042 TAATGCCTTCTCCTTGGGCACGG 0: 1
1: 0
2: 2
3: 20
4: 197
955445419_955445423 7 Left 955445419 3:59004984-59005006 CCTTACTCTATCCATACCTTTTG 0: 1
1: 0
2: 2
3: 20
4: 201
Right 955445423 3:59005014-59005036 ATTTTGTAATGCCTTCTCCTTGG 0: 1
1: 0
2: 1
3: 20
4: 249

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
955445419 Original CRISPR CAAAAGGTATGGATAGAGTA AGG (reversed) Intronic
902209255 1:14892871-14892893 AAAAAGGAATGGACAGAGGAAGG + Intronic
906239188 1:44231325-44231347 CAATATATATGGAGAGAGTAAGG - Intronic
906697563 1:47833654-47833676 CAAAAGGTATGGGTATTATAAGG - Intronic
909235292 1:73145462-73145484 CAAAAGGTAGGGATACACTGAGG - Intergenic
909763420 1:79323536-79323558 CAAAAGGCATGAAGGGAGTATGG + Intergenic
911634474 1:100218914-100218936 CTAATGGTATGGGTAGAGTGGGG + Intronic
914509302 1:148317483-148317505 CAAAAGGGATGGGGAGAGTTTGG - Intergenic
915523194 1:156460361-156460383 CATAAGGTATGGAGAGACTATGG - Intergenic
916484688 1:165248324-165248346 CCAAAGGGATGGATAGAGTGAGG + Intronic
917263391 1:173194006-173194028 CAAAAGGTCTGGGTAGATCAAGG + Intronic
918932398 1:190871750-190871772 CAAAACTTATGGAAAGAGTCAGG + Intergenic
919054132 1:192547965-192547987 CAAAGGGGATGAATACAGTAGGG + Intergenic
919329531 1:196152497-196152519 TAAAGGGTATGGATAAAGGAAGG + Intergenic
919692263 1:200538559-200538581 CAAAGGGTATGGATATAGGAAGG + Intergenic
919731784 1:200917298-200917320 CAAAAGGAATTGGTTGAGTAGGG - Intergenic
921307319 1:213810057-213810079 CAAAGGGTAAGGGTAGAGGATGG - Intergenic
924802755 1:247339491-247339513 AAAATGCTATGGAAAGAGTAAGG - Intergenic
1063744630 10:8866603-8866625 TCAAATGTATGTATAGAGTAAGG + Intergenic
1063924719 10:10966525-10966547 AAAATGGTAGGGTTAGAGTATGG - Intergenic
1066166794 10:32797514-32797536 CAAAGGGTAGGGAGGGAGTAAGG + Intronic
1069235926 10:66073081-66073103 CAAAAGGAGAGAATAGAGTAGGG + Intronic
1071330201 10:84551421-84551443 CAGAAGGTAAGCAAAGAGTAAGG + Intergenic
1071746504 10:88425844-88425866 CAAAAAGAATGGTAAGAGTAGGG + Intronic
1071901216 10:90121879-90121901 CAAAAGGGAGGTATAGAATAAGG - Intergenic
1073838189 10:107468573-107468595 AAAATGAGATGGATAGAGTATGG + Intergenic
1075417926 10:122279099-122279121 CAAAAGGTTTGGACAGAGGGAGG + Intronic
1077737060 11:4802275-4802297 CAAAAGGTGGGGATAGAATAGGG - Intronic
1077881003 11:6350062-6350084 CAAAAAGTATGGATACAGGGAGG - Intergenic
1079090896 11:17479576-17479598 CAAAAGGCATGGCTAGAGGTGGG - Intergenic
1079415246 11:20228848-20228870 CCATAGGTATGGACAGAGCAGGG + Intergenic
1079482861 11:20900422-20900444 CACAAGGTATGGACACAGTGAGG + Intronic
1079656727 11:22994494-22994516 GAAAAGGTTTGGTTAGAGGAGGG + Intergenic
1080563157 11:33483115-33483137 CAGAAGGAAAGGATAGAGGAAGG - Intergenic
1081824152 11:46031220-46031242 CAAAAGGTATGGAAAGAGGTTGG - Intronic
1081948685 11:47022690-47022712 CAGAGGATATGGATAGTGTATGG - Intronic
1082021765 11:47540072-47540094 CACAAGGTATAATTAGAGTAGGG + Intronic
1084260149 11:67971782-67971804 CAAAAGATAAGGATACAGCATGG + Intergenic
1084812620 11:71623475-71623497 CAACAGATAAGGATAGAGCATGG - Intergenic
1086784378 11:90948294-90948316 AAAAAGGTAGTGATAGAGAAAGG + Intergenic
1087784299 11:102337780-102337802 AAGAAGGTATGGAAAGAGTCTGG - Intronic
1088985910 11:114908087-114908109 CAAAGGGCATGGATACAGGAAGG + Intergenic
1090427098 11:126615614-126615636 CAATAAGTATGGATTGAGTTAGG + Intronic
1091385121 12:89055-89077 CCAAAGGTGAGCATAGAGTAGGG + Intronic
1092404737 12:8211683-8211705 CTGGAGGTATGGATAGAGTCAGG + Intergenic
1093999579 12:25680637-25680659 CACAAAGTATGGATTGAGTCAGG - Intergenic
1094255208 12:28416345-28416367 CAAAGGGTATAGATATTGTATGG + Intronic
1094404369 12:30099134-30099156 AAAAATGTCTGGAAAGAGTAAGG + Intergenic
1094580896 12:31733153-31733175 CCAAAGGTGTGGACAGAGTTAGG + Intergenic
1095233920 12:39774856-39774878 CAAAATAGATGGATGGAGTATGG + Intronic
1096053439 12:48631136-48631158 CAAAAGGTATGGATAGAAAAGGG - Intergenic
1096056848 12:48660158-48660180 AAAAAGGTATGGGAAGAGTCTGG + Intronic
1096960999 12:55577475-55577497 CAAGAGATATGGATATAGAAAGG - Intergenic
1097039429 12:56146280-56146302 AAAAAGGTTAGGAAAGAGTAGGG - Intergenic
1098194434 12:67984991-67985013 CAAAAAGTATGGATACAGGGAGG + Intergenic
1098581694 12:72107134-72107156 CAAAGTGTATGGATACATTAAGG - Intronic
1100663121 12:96722171-96722193 GAAAATGTATGGAGAAAGTAAGG - Intronic
1103062177 12:117867447-117867469 CAAAGGGTATGGACACAGGAGGG - Intronic
1103523357 12:121550807-121550829 CAAAACGTATGGCTATTGTAGGG - Intronic
1105489617 13:20875199-20875221 CAAAAAGTAAGGAAAGATTATGG - Intronic
1106107552 13:26746710-26746732 AAAAAGGTGTGGACAGAGGATGG - Intergenic
1107806686 13:44159912-44159934 CAAAAGGTGGGGAAAGAGGAAGG + Intronic
1108821360 13:54354640-54354662 CAAAATGAATTTATAGAGTAAGG - Intergenic
1110661421 13:78062534-78062556 CAAGAGGTTTGGATATAGTAGGG - Intergenic
1112946326 13:104931163-104931185 GAAAAGGTTTGGATAGAGACAGG - Intergenic
1113174057 13:107541104-107541126 TAAAAGCTTTGGATTGAGTAGGG - Intronic
1114744247 14:25130534-25130556 CAAAAGGCAGGGATAAAATAAGG + Intergenic
1114744369 14:25132058-25132080 CAAAAGGCAGGGATAAAATAAGG + Intergenic
1116977352 14:51131083-51131105 CAAAAGGAATGGATTGAGGTGGG - Intergenic
1120355501 14:83428249-83428271 CCAAAGATATGGACAGAGTGAGG + Intergenic
1120794367 14:88616326-88616348 CAAGAGCTGTGGAGAGAGTAGGG + Exonic
1126288784 15:47047459-47047481 TAAAAGCTGTGGATAGAGTATGG + Intergenic
1130178615 15:81602158-81602180 CAAAAGGTATGCACATAGTAAGG + Intergenic
1130351511 15:83096322-83096344 AAAAAGGAATAAATAGAGTAAGG + Intergenic
1134352780 16:13453324-13453346 CAAAAGGTGTGGATAAAGGTAGG - Intergenic
1135858595 16:26034493-26034515 CAAGAGGTCTGGAAAGAGAAGGG - Intronic
1136644151 16:31595105-31595127 CAAAGGGCATGGATAGAGAGAGG + Intergenic
1137938103 16:52655119-52655141 CAATATGTATGGATATAGAATGG + Intergenic
1140180783 16:72715959-72715981 CAAAGGATATGGATACAGGAAGG + Intergenic
1141814175 16:86398154-86398176 CAAAAGGAGTGGATACAGGAAGG + Intergenic
1148572937 17:48684996-48685018 CAGCAGGTATGGATAGAGGCTGG + Intergenic
1151764937 17:76128236-76128258 TAAAAGGTATTCATAGAGAATGG + Intergenic
1155792529 18:29992099-29992121 AAAAATGTATTGATAGAGAAAGG - Intergenic
1156670265 18:39460464-39460486 AAAGAGGCATGCATAGAGTATGG - Intergenic
1158196439 18:54891069-54891091 CAAAAAATATGCACAGAGTATGG - Exonic
1162135769 19:8554460-8554482 CATTAGGTATGGACAGAGTTGGG - Exonic
1166573191 19:43812291-43812313 CAAAAGGTGTGGATAGAGGGAGG + Intronic
1167573211 19:50303581-50303603 CCAAGGGTATGGATACAGAAAGG + Intronic
925590075 2:5500775-5500797 CAAAAGGAAGGGAGAGAGAAGGG + Intergenic
928098511 2:28420699-28420721 CACAGGCTATGGATAGACTACGG - Intergenic
929433114 2:41905563-41905585 CAAAAGTCATGGATAGAGGGAGG - Intergenic
932057018 2:68455910-68455932 CAAAAGGGACGGACAGAGAAAGG - Intergenic
933123268 2:78570086-78570108 CAAAAAAGATGGAGAGAGTATGG + Intergenic
935426523 2:102924297-102924319 CAAAAGGCATGGTTAGAGGGAGG + Intergenic
938080124 2:128365457-128365479 CACAAGGTATGAATAGAGCAGGG - Intergenic
941155924 2:161977868-161977890 CAAAAGGCATGGAGAGTGTTGGG + Intronic
941528069 2:166630694-166630716 CAAAAGGCAAGGATAAAGAAAGG - Intergenic
944024083 2:195142982-195143004 CAAAAGGTATTTCTGGAGTAAGG + Intergenic
944511585 2:200471309-200471331 CAAAAGCTGGGGATAGAGAATGG - Intronic
944960145 2:204863142-204863164 CAAGAGGTATTGATAGAGACAGG - Intronic
945573194 2:211496839-211496861 CAAAAGGCATGAAGAAAGTAGGG - Intronic
945934564 2:215889891-215889913 GAAAAGGTAAGAATAGAATAGGG - Intergenic
1173489411 20:43467580-43467602 CAAAAACTGTGGATAGAGTCAGG + Intergenic
1174828417 20:53790577-53790599 CAAAGGGTATGGATACAGGGAGG - Intergenic
1175623554 20:60471377-60471399 TGAAAGGTATGTATACAGTAGGG + Intergenic
1179628865 21:42664639-42664661 CAAAAGGCAAGGAAAGAGGAGGG + Intronic
1182114628 22:27748989-27749011 CAAAAGGAATGGAAAGGGAAGGG - Exonic
1182394535 22:30025975-30025997 GAAAAGGTAGGGAGGGAGTAGGG - Exonic
1182916823 22:34041255-34041277 CAAACGGCAAGGATAGAGGAAGG - Intergenic
949426429 3:3922098-3922120 GGAAAGGTATAGAGAGAGTACGG - Intronic
949556969 3:5162903-5162925 CAAAAAGTGGGGAGAGAGTAAGG - Intronic
950398445 3:12752079-12752101 CAAAAGCTAGGGATAGTGGAGGG - Intronic
953171969 3:40515019-40515041 CAAAAGGTTTTGATAGTGGAGGG + Intronic
954256969 3:49413699-49413721 CAAAGGGAATGGATTGAGCAAGG + Intronic
955445419 3:59004984-59005006 CAAAAGGTATGGATAGAGTAAGG - Intronic
958163971 3:89855161-89855183 CCAAAGATTTTGATAGAGTAGGG - Intergenic
959646089 3:108703401-108703423 CAAAAGTTAAGGATAAAGAAAGG - Intergenic
963104269 3:141632574-141632596 CAAAAGGAACGGAGAGAGAAGGG + Intergenic
963811712 3:149783860-149783882 CAAAAGGTATGAAAAGAATCTGG - Intronic
964919115 3:161874681-161874703 CAAAAAGTAAGGATACATTATGG - Intergenic
964978310 3:162646839-162646861 CAACTGGTATGAATAGAGTGAGG + Intergenic
965144808 3:164888268-164888290 CAAAGGTTATGGATAAAGAAAGG - Intergenic
965943798 3:174215889-174215911 TAAAAGGAATGGAGAGAGGAAGG - Intronic
966481003 3:180408540-180408562 CAAAATGAATGCATAAAGTATGG + Intergenic
966863001 3:184241115-184241137 CCAAAGGTAGGGAAAGGGTAGGG + Intronic
967757783 3:193189523-193189545 CTAAAAGTATGGAAAGAGTAGGG + Intergenic
968979636 4:3839789-3839811 CAAGAAATATGGATAGGGTAGGG + Intergenic
969794507 4:9516331-9516353 CAACAGGTAAGGATACAGCATGG - Intergenic
971546188 4:27890354-27890376 GAATTGGTATGGATAGAGTGGGG + Intergenic
971710331 4:30103004-30103026 TAAAAGGTATGGATAGTAAAAGG + Intergenic
972796636 4:42427860-42427882 CTAAAGGTATTGATTGATTATGG + Intronic
973787955 4:54351793-54351815 CAAAGGGTATGGATACAAGAAGG - Intergenic
974545285 4:63298045-63298067 TTAAAGGTATGAATGGAGTAAGG - Intergenic
975158325 4:71096314-71096336 CAGACGGTATGTATAGAGAAAGG + Intergenic
976689944 4:87858084-87858106 CAAAAGGTATGGTGAGAGGAGGG + Intergenic
976752949 4:88468641-88468663 CAAAAGGTAAGTATAGCCTATGG - Intronic
978084966 4:104640299-104640321 AAAATGGAATGAATAGAGTAAGG + Intergenic
978769364 4:112438081-112438103 TAAAAGGAAGGGATAGAGGAAGG + Intronic
979605805 4:122637525-122637547 CAAAGGGTAAGGATAGAGGGAGG + Intergenic
980108680 4:128613534-128613556 TAAAAGGTCTGGAAAGAGTTGGG - Intergenic
980952333 4:139393876-139393898 CAAAAGGTAGGGATAGGCTATGG + Intronic
981755325 4:148136278-148136300 CAAAAGGAAGGGAAAGAGAAAGG + Intronic
981912012 4:149992975-149992997 CAAAGGGTATGGATACAGGGAGG - Intergenic
983375584 4:166923306-166923328 CAAAAGATATGGTTACATTAAGG - Intronic
986487338 5:8250824-8250846 AGAAAGGTATGGAAAGAATAAGG + Intergenic
986615672 5:9614892-9614914 AAAAAGCTATGGCTACAGTAAGG + Intergenic
988559282 5:32265958-32265980 GAAAAGGTATAGATAGATTTTGG - Intronic
988772852 5:34449483-34449505 CAAAAGGTATAGTAAGAATATGG + Intergenic
992971394 5:82062684-82062706 CTAAAGGTAAGAATAGAATATGG - Intronic
995925917 5:117374143-117374165 GAATAAGTATGGATACAGTATGG - Intergenic
995997202 5:118315692-118315714 CACGAGGTATAGATAGAGTAGGG + Intergenic
997225108 5:132204065-132204087 CAAAAGGTAAGCAAAGAGCAGGG - Exonic
998967367 5:147555098-147555120 CAAAATTTATGGAAAGAGTAAGG - Intergenic
999101448 5:149028996-149029018 CAAGAGGTATGGGTACTGTAGGG + Intronic
999696645 5:154192968-154192990 AAGAGGGTATTGATAGAGTAAGG + Intronic
1002086066 5:176776385-176776407 CAAAGGGTATGGATACAGAGAGG + Intergenic
1004084918 6:12437459-12437481 GAAAGAGTATGGATAGATTAAGG + Intergenic
1005423571 6:25678164-25678186 AAAAATGTGTGGATGGAGTATGG + Intronic
1006553992 6:34850282-34850304 CAAAAGTCAAGGATAGAGAAAGG - Intronic
1006733930 6:36258463-36258485 CAAAAGGCATGGATATTGGAGGG - Intronic
1008306141 6:49902526-49902548 GAAAAGGTAAGGAGACAGTAAGG - Intergenic
1009613983 6:65981787-65981809 CAAAAAGCAAAGATAGAGTAAGG - Intergenic
1012928266 6:105289866-105289888 AAAAAGCTATGGATAAAATATGG - Intronic
1013734122 6:113205892-113205914 CAAAAAGAAGGGATAGAGAAAGG - Intergenic
1014901673 6:126973104-126973126 CAAAGGGTAAGGATAGAGAGAGG + Intergenic
1015021437 6:128480480-128480502 GAAGAGGAATGGATAGAGCACGG - Intronic
1015566325 6:134575264-134575286 CAATAGGATTGGATAGAGAAAGG + Intergenic
1015790297 6:136958507-136958529 TAAAAGCCATGAATAGAGTAAGG + Intergenic
1019881299 7:3863602-3863624 CAAAAGTTATAGAGAGAGTGAGG - Intronic
1020521183 7:9189519-9189541 CAAAAGGAAAGGACAGAGTTGGG + Intergenic
1021026917 7:15679831-15679853 AAAAATGTATAGATACAGTACGG + Intronic
1021531257 7:21648285-21648307 CAAAGGGCATGGATACAGGAAGG - Intronic
1022758749 7:33324903-33324925 CAAAAGGCAAGGATAAAGAAAGG - Intronic
1028222724 7:88216332-88216354 CAAAAGGCAGGGGTAGGGTAAGG + Intronic
1028390464 7:90310835-90310857 CAAAACATATGGATAGAGTGGGG + Exonic
1029614438 7:101647491-101647513 CAAAAGGCCTGGATAGAGGCTGG + Intergenic
1030424491 7:109356755-109356777 CAAAAAGGAAGGCTAGAGTAGGG - Intergenic
1030463437 7:109869682-109869704 CAAAAATTATGAAGAGAGTATGG - Intergenic
1030505267 7:110414031-110414053 AAAAAGGTTTGGATGGAGAAAGG - Intergenic
1030711723 7:112757699-112757721 TAAAAGCCATGGAAAGAGTAAGG + Intergenic
1031045625 7:116884140-116884162 AAAAAGGCAAGGAGAGAGTAGGG - Intronic
1035835607 8:2748516-2748538 CAAAAGGTATAGATACACAATGG + Intergenic
1036271484 8:7308169-7308191 CTGGAGGTATGGATAGAGTCAGG - Intergenic
1036349864 8:8002180-8002202 CTGGAGGTATGGATAGAGTCAGG + Intergenic
1036845137 8:12162710-12162732 CTGGAGGTATGGATAGAGTCAGG + Intergenic
1036866506 8:12405033-12405055 CTGGAGGTATGGATAGAGTCAGG + Intergenic
1037873029 8:22517603-22517625 CAGAAGAAATGGATAGAGTCTGG - Intronic
1039528105 8:38233952-38233974 AAAAAAGTATGTATAGAGTGGGG + Intronic
1040776613 8:51051166-51051188 CAAAAATTATGAATATAGTAGGG + Intergenic
1040970177 8:53127460-53127482 CAAAAGGTATGGATACAGGAAGG - Intergenic
1041992346 8:64008551-64008573 CAAAGGATCTGGATAGAGCAAGG + Intergenic
1042968642 8:74383704-74383726 CCAACTGTATGGAGAGAGTATGG - Intronic
1045340018 8:101245367-101245389 CAATGGGTATGGATACAGTGAGG - Intergenic
1045898731 8:107248709-107248731 CAAAAGGTATGAATACAGAAAGG + Intergenic
1047762724 8:127966257-127966279 CAAAAGCTGTGGAAAGAGTCAGG + Intergenic
1047989009 8:130265926-130265948 CAGAAGTTCTGGATAAAGTATGG + Intronic
1048321244 8:133401873-133401895 CAAAAGGCATGGATGCAGGAGGG + Intergenic
1048456264 8:134581370-134581392 CAAAAGGGATGGAAATAGGAGGG - Intronic
1048582807 8:135744351-135744373 GAACAGCTATGGAAAGAGTAGGG - Intergenic
1050747763 9:8897340-8897362 CAGAAGGTATGGATTGAGCTGGG + Intronic
1051047883 9:12897227-12897249 AAAAAGGAGGGGATAGAGTAGGG + Intergenic
1051166418 9:14266781-14266803 CAACAGGAATGGATAGATTCTGG - Intronic
1052293802 9:26874772-26874794 CTTAAGGTATGGTAAGAGTAGGG + Intronic
1052304679 9:26993783-26993805 CTAGAGGTATGGATGGAGCAAGG - Exonic
1052344562 9:27396302-27396324 CGAAAGCTATGAATAGAGAAGGG - Intronic
1053021665 9:34699155-34699177 CAGAAGGTATGAATAAAGCATGG + Intergenic
1055123904 9:72696332-72696354 CAAAACCTATGGAGAGAGTTGGG - Intronic
1056334287 9:85550873-85550895 CATAAGGTATTGATAGGGTTTGG + Intronic
1185699991 X:2223578-2223600 CGAAAGGGATGGAAAGAGGAAGG + Intronic
1186706394 X:12144000-12144022 CAAAATGTATGGAAAAAGAATGG + Intronic
1187277651 X:17830030-17830052 CAAAAGGAAAGGATAGAGTTGGG - Intronic
1187554799 X:20341462-20341484 GAAAATGGATGGATGGAGTAAGG + Intergenic
1187567404 X:20465124-20465146 CAAGGGGTATGGATATAGAAAGG - Intergenic
1187753721 X:22496724-22496746 CAAAGGGCATGGATACAGGAAGG - Intergenic
1189799063 X:44675326-44675348 CAAAGGATATGGATATAGCAAGG - Intergenic
1189855587 X:45221787-45221809 CAAAAGTCATGGATAAAGAAAGG - Intergenic
1190727684 X:53201081-53201103 CAAGATGTAAGGTTAGAGTAAGG - Intronic
1192146288 X:68685137-68685159 AACAAGGTATGGAGACAGTAGGG + Intronic
1192722573 X:73714968-73714990 GAAAAGGTATGGATACAATACGG - Intergenic
1193131790 X:77927963-77927985 CAAAAGGTATGTATATTTTAAGG + Intronic
1195763292 X:108270230-108270252 CAAATGACATGGATAGAGTAGGG - Intronic
1196155548 X:112424694-112424716 GGAAAGGTATAGAAAGAGTAGGG + Intergenic
1196630828 X:117937614-117937636 CAAATGGTATGGAAACACTAGGG - Intronic
1199708200 X:150449419-150449441 GAAAAGGGATGGATAGAATGAGG - Intronic
1199864296 X:151829029-151829051 CAAAAGCTTTTGATAGAGTTGGG - Intergenic