ID: 955445643

View in Genome Browser
Species Human (GRCh38)
Location 3:59007154-59007176
Sequence CACCCCCAACTCCCCAACAG TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 315
Summary {0: 1, 1: 1, 2: 3, 3: 35, 4: 275}

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
955445638_955445643 -5 Left 955445638 3:59007136-59007158 CCCCATTGGCCTGAGAACCACCC 0: 11
1: 23
2: 49
3: 45
4: 166
Right 955445643 3:59007154-59007176 CACCCCCAACTCCCCAACAGTGG 0: 1
1: 1
2: 3
3: 35
4: 275
955445635_955445643 10 Left 955445635 3:59007121-59007143 CCCTCTGGAACAAAACCCCATTG 0: 2
1: 18
2: 34
3: 55
4: 202
Right 955445643 3:59007154-59007176 CACCCCCAACTCCCCAACAGTGG 0: 1
1: 1
2: 3
3: 35
4: 275
955445639_955445643 -6 Left 955445639 3:59007137-59007159 CCCATTGGCCTGAGAACCACCCC 0: 10
1: 25
2: 52
3: 64
4: 162
Right 955445643 3:59007154-59007176 CACCCCCAACTCCCCAACAGTGG 0: 1
1: 1
2: 3
3: 35
4: 275
955445636_955445643 9 Left 955445636 3:59007122-59007144 CCTCTGGAACAAAACCCCATTGG 0: 2
1: 17
2: 35
3: 82
4: 258
Right 955445643 3:59007154-59007176 CACCCCCAACTCCCCAACAGTGG 0: 1
1: 1
2: 3
3: 35
4: 275
955445634_955445643 18 Left 955445634 3:59007113-59007135 CCATACTTCCCTCTGGAACAAAA 0: 1
1: 1
2: 4
3: 62
4: 298
Right 955445643 3:59007154-59007176 CACCCCCAACTCCCCAACAGTGG 0: 1
1: 1
2: 3
3: 35
4: 275
955445640_955445643 -7 Left 955445640 3:59007138-59007160 CCATTGGCCTGAGAACCACCCCC 0: 12
1: 58
2: 162
3: 205
4: 475
Right 955445643 3:59007154-59007176 CACCCCCAACTCCCCAACAGTGG 0: 1
1: 1
2: 3
3: 35
4: 275

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
955445643 Original CRISPR CACCCCCAACTCCCCAACAG TGG Intronic
900417066 1:2540188-2540210 CACCCCCAATTCTCCAGCAAGGG - Intergenic
900784792 1:4642241-4642263 CACACCCAAATGCCCATCAGTGG - Intergenic
901274963 1:7984019-7984041 CACCCCCACCTCCCCAAATTAGG - Intronic
901656971 1:10774971-10774993 CACACACAACACCCCAACAAGGG + Intronic
902604063 1:17559018-17559040 CTCCCCCCACACCCCAACTGAGG - Intronic
903678800 1:25083391-25083413 TGCCCCCAACTCCCCATCACTGG + Intergenic
904031584 1:27536704-27536726 CACCCCCAACACCCCAACAGAGG - Intronic
904408681 1:30311769-30311791 CACCCCCTTCTCCCCAGCAGTGG - Intergenic
905009406 1:34737037-34737059 CACACCCACCCCCCCAACAGAGG + Intronic
905532662 1:38694497-38694519 CACTCCATCCTCCCCAACAGAGG + Intergenic
905552224 1:38851340-38851362 CTCCCCCATCCCCACAACAGTGG + Intronic
906688076 1:47775321-47775343 GACCCCCACCGCCCCACCAGAGG - Exonic
907345368 1:53773810-53773832 CACCCACAACTCCCCCAGACTGG + Intronic
907360684 1:53911951-53911973 CACCTCCAACCCCCCAAAAAAGG - Intergenic
907968974 1:59361923-59361945 CACCCCCCACCACCCAAGAGAGG - Intronic
908554596 1:65245235-65245257 CACCCACAACCCCACAAAAGGGG + Intergenic
910673292 1:89794722-89794744 CACCCCCCACCCCCCAAAATAGG - Intronic
912439577 1:109688034-109688056 CACCCCCAACACACACACAGCGG - Intronic
913302673 1:117388679-117388701 AAGCCCCACCTCCCCAACACTGG + Intronic
914947756 1:152081094-152081116 CACCCCCAACAGCCCCACAGGGG - Intergenic
915917680 1:159950795-159950817 CACCCCCAACTCCCTGGCAAAGG - Intergenic
915920761 1:159973618-159973640 TACCCCCATCTCCCCACCATGGG - Intergenic
916120123 1:161522229-161522251 AACCCCCAACAACCCTACAGTGG + Intronic
918310188 1:183280119-183280141 CTGGCCCAACTCCCCAACTGTGG + Intronic
920263447 1:204705434-204705456 CACACACACATCCCCAACAGCGG + Intergenic
920850522 1:209625219-209625241 CACCCCCATCCCACCAGCAGAGG - Intronic
921233348 1:213096844-213096866 CACCCCCAATTACCCAACAATGG - Intronic
922815610 1:228446700-228446722 CCCCCCCAACCCCCCAACGCTGG - Intergenic
923316870 1:232789002-232789024 CTCCACCAACTCACCAACTGGGG - Intergenic
924124490 1:240836130-240836152 CACCCCCAACCCCACCAGAGCGG - Intronic
924499073 1:244619275-244619297 CACCCCAAATTCCTTAACAGTGG - Intronic
1062824196 10:556442-556464 CACCCACACCTTCCCAAGAGGGG + Intronic
1063580030 10:7297919-7297941 CACCCCCACCACCTCCACAGTGG + Intronic
1064217189 10:13410153-13410175 CACCCCCAGCGCCCCAGCATGGG - Intergenic
1065022074 10:21509465-21509487 CACTCCAACCTCCCCAACCGAGG + Intergenic
1066026596 10:31364335-31364357 CACCCCCAACAGCCCCACAGGGG - Intronic
1067771233 10:49127712-49127734 CTCCCCCAACCCCACAACAAAGG - Intergenic
1067828644 10:49597415-49597437 CACCTCCAGGTCCCCATCAGAGG + Intergenic
1070704565 10:78628434-78628456 CACCCCCATCTCCTCAGCAGAGG - Intergenic
1071678904 10:87684688-87684710 GACACCCAACTGCCCATCAGTGG - Intronic
1073049430 10:100657893-100657915 CACCCCCACCTCCCCAGCTTAGG - Intergenic
1073180915 10:101582673-101582695 AACCCCCAACTCCTCAGCTGGGG - Intronic
1074489165 10:113923420-113923442 CACTCCCATCTCCAGAACAGTGG + Intergenic
1074884647 10:117684543-117684565 CACCCCAGACTCCCCTACCGTGG - Intergenic
1074989055 10:118686260-118686282 CTCTCCCAACTCCCCAAAAAAGG + Intronic
1075337290 10:121617609-121617631 TGCCCCCAACACCCCAAAAGAGG + Intergenic
1077603624 11:3591833-3591855 CACTCCCAATCCCCCAACACAGG - Intergenic
1078463050 11:11530084-11530106 CATCCCCTCCTCCCCAACACAGG + Intronic
1079099274 11:17530858-17530880 CCTCCCCTACTCCCCAAGAGAGG - Intronic
1079633896 11:22711817-22711839 CACCCCAAAAACCCCCACAGTGG + Intronic
1080601520 11:33825342-33825364 CACCTCCAGCTCCCCAGTAGTGG + Intergenic
1084259522 11:67966429-67966451 CACTCCCAATCCCCCAACACAGG - Intergenic
1084316684 11:68349752-68349774 CACCCCAGACTCCCGAGCAGAGG + Intronic
1084813245 11:71628822-71628844 CACTCCCAATCCCCCAACACAGG + Intergenic
1085477629 11:76797983-76798005 TTCCCCCAACACCCCAACACAGG - Exonic
1086769151 11:90739166-90739188 CACCCCCAACTCCTCAAGCTTGG + Intergenic
1087619889 11:100529014-100529036 CTCCCCCAACTCCCCACCACTGG + Intergenic
1088903468 11:114136285-114136307 CACCCTCAGCCCCCAAACAGTGG - Intronic
1089422293 11:118340891-118340913 CTCCCCCTACTCCTCATCAGTGG - Intronic
1089797015 11:120989053-120989075 CACCCCCCCATCCCCAAAAGCGG + Intergenic
1089908003 11:122065330-122065352 CACCCTGAACTAACCAACAGAGG - Intergenic
1090242133 11:125191620-125191642 CCACCACAACTTCCCAACAGTGG - Intronic
1090741800 11:129668916-129668938 CACCCCCAACACCGCCACACTGG - Intergenic
1091385804 12:93798-93820 CACCCCCAACTCCCCAGAGAGGG - Intronic
1092008377 12:5088350-5088372 CACCTCCAACTCCCCTCCTGTGG - Intergenic
1092430837 12:8407393-8407415 CACTCCCAATCCCCCAACACAGG - Intergenic
1093841558 12:23908743-23908765 CAACCCAAACTCCAAAACAGCGG + Intronic
1094498706 12:31005338-31005360 CCCTGCCAACTCCCCCACAGTGG + Intergenic
1100329797 12:93572087-93572109 CACCCCCAACCCCGCCAGAGCGG + Exonic
1102477980 12:113201247-113201269 CACCCCCAACCCCACAATGGAGG + Intronic
1103007872 12:117436214-117436236 CTCCCCCACCTCCCCAACTGAGG + Intronic
1103039835 12:117685767-117685789 CACCCCCAACCCACCACCAGAGG + Intronic
1103596030 12:122024637-122024659 CAACCCCACCCCCCCACCAGTGG - Intronic
1103946311 12:124528643-124528665 CACCCTCATCTCTCCAGCAGAGG + Intronic
1104585274 12:130043766-130043788 CACACACACCTCCCAAACAGTGG + Intergenic
1104766544 12:131333699-131333721 CCCTCCCAACTCCACATCAGCGG - Intergenic
1104812866 12:131628944-131628966 CCCTCCCAACTCCACACCAGCGG + Intergenic
1105425068 13:20286913-20286935 GACCCCCAACTCTCCAAAGGGGG + Intergenic
1107253297 13:38392142-38392164 CACCCCCACATCCCCTACAGTGG - Intergenic
1110626958 13:77662912-77662934 CACCCCCAACAGCCCCACAGGGG - Intergenic
1111812286 13:93106049-93106071 CACCCCCTACACTCCAACAGCGG + Intergenic
1114694343 14:24612594-24612616 CACCCCCACATCCCGCACAGTGG - Intergenic
1119192062 14:72689594-72689616 CACCCCCTATCCCCAAACAGTGG + Intronic
1119509504 14:75199765-75199787 CAATCCCAACTCCTCACCAGGGG + Intergenic
1120926694 14:89804163-89804185 CACCCCCTACCCCCCAAACGTGG + Intronic
1122209602 14:100166064-100166086 CTCCCCCAACTCCCCCAGACAGG - Intergenic
1122255085 14:100470702-100470724 CTCCTCCAACTCTCCACCAGGGG - Intronic
1122272354 14:100573890-100573912 CACCTCCTGATCCCCAACAGTGG - Intronic
1122887137 14:104715084-104715106 CGCCCCCTACTCCCTAACGGAGG - Intronic
1122971741 14:105155006-105155028 CACCCCCACATGCCCCACAGCGG + Intronic
1202855003 14_GL000225v1_random:44416-44438 CAACCCCCACACCCCAACACCGG + Intergenic
1124163689 15:27298836-27298858 AGCCCCCCACCCCCCAACAGGGG + Intronic
1124223401 15:27869255-27869277 CACCCTCAGCACCCCCACAGCGG + Intronic
1124892953 15:33749621-33749643 CACTCCCAACTCCCCGTCTGAGG + Intronic
1127312538 15:57765530-57765552 CATCCCCAACTCCCAAAATGGGG + Intronic
1129466673 15:75728080-75728102 CTCTCCCAACTCCCAACCAGAGG - Intergenic
1129612117 15:77069696-77069718 CTCCCCCGACCCCCCAACAAGGG - Intronic
1130320707 15:82838349-82838371 TACCCCCTACTTCCCAGCAGTGG - Intronic
1130547164 15:84865173-84865195 TACCCAGAACTCCCCAACAAAGG + Intronic
1130937513 15:88482778-88482800 CACCCCCACCTCCCACCCAGTGG - Intergenic
1131066004 15:89435517-89435539 CACCCCCCACCACCCACCAGGGG - Intergenic
1131318708 15:91366102-91366124 CACCCCCTACTCCTTAGCAGTGG + Intergenic
1131551931 15:93364738-93364760 CTCCTCCAACTCCCTCACAGTGG - Intergenic
1132576345 16:666119-666141 CACACCCAACTCCTCACCATCGG - Exonic
1132880733 16:2160707-2160729 CACCCCCACTTCCCCAGCACTGG + Intronic
1133033446 16:3022288-3022310 CCCCCCCAACTCCCCAAAGCGGG + Exonic
1133426489 16:5694775-5694797 CAAACCCAACTCCCCAAAAAAGG - Intergenic
1135489722 16:22898985-22899007 CACCTCCAACTACCCACTAGGGG + Intronic
1135640823 16:24118483-24118505 CACTCCCAGCTACCCAGCAGTGG - Intronic
1136791068 16:32968520-32968542 CCCCCCCACCTCCCCCACAAAGG + Intergenic
1136878745 16:33885412-33885434 CCCCCCCACCTCCCCAACAAAGG - Intergenic
1137292694 16:47062643-47062665 CACCTCCAAATACCCTACAGTGG - Intergenic
1137512656 16:49115122-49115144 CACCCGCATCCCCCCATCAGAGG + Intergenic
1137890432 16:52155772-52155794 CTCCCCCAAACCCCCACCAGTGG + Intergenic
1138383062 16:56617144-56617166 CACCCCCACCACCCCATCTGCGG - Intergenic
1138694244 16:58796858-58796880 CACCCCCAACTCCTCGTCTGTGG + Intergenic
1138829617 16:60359987-60360009 CACCCCCAACAGCCCCACAGGGG - Intergenic
1140921841 16:79545600-79545622 CAACCCCCACCCCCCCACAGAGG + Intergenic
1141412805 16:83846920-83846942 CCCTCCCAACTCCCTACCAGGGG + Intergenic
1141618097 16:85221583-85221605 CAGCCCCAACTCCCCAGCCAGGG + Intergenic
1142401415 16:89860715-89860737 CACCCCCTACTCAGCAACCGGGG + Exonic
1144006456 17:11104560-11104582 CTCCCCCCACCCCACAACAGGGG + Intergenic
1146450406 17:32969596-32969618 CACCCCCAACACCCCACAACAGG - Intergenic
1147153340 17:38531096-38531118 CCCCCCCACCTCCCCCACAAAGG + Exonic
1147261695 17:39212811-39212833 CAGCCCAAATTCCCCAGCAGGGG + Intronic
1147760118 17:42792542-42792564 CACCCCCATCCCCCCAACCCTGG + Intronic
1147988817 17:44321229-44321251 CACCCCCAATCCCCACACAGTGG - Exonic
1148681688 17:49477762-49477784 CACCCCCATCCCCACAACAGTGG - Intergenic
1148848130 17:50540996-50541018 CACCACAAACTCCCCAGCACTGG + Exonic
1149582666 17:57762178-57762200 CACCCCCAGCCCCCCTACACCGG + Intergenic
1150291891 17:63987152-63987174 CAGCCCCATCCCCCCAACAAGGG + Intergenic
1150686553 17:67325730-67325752 CTCCCCCAACTGCCCATTAGAGG - Intergenic
1151965497 17:77429128-77429150 CACCCCCAAGTCCCCACCCCAGG - Intronic
1152799941 17:82326150-82326172 CTGCCCCCACCCCCCAACAGTGG - Intronic
1153759020 18:8312297-8312319 CTCCCCCAAACCCCCAACAGTGG + Intronic
1156269061 18:35514346-35514368 CACCCCCAACTCCCCATCAAAGG - Intergenic
1156364024 18:36408977-36408999 CAGACCCAGCTCCCCAGCAGGGG - Intronic
1156866696 18:41896571-41896593 AACCCCCAACTCCCCATTATAGG + Intergenic
1157070745 18:44405001-44405023 CATCCCCAACTCCAAAACTGAGG + Intergenic
1161371549 19:3914868-3914890 CACCCCCAACACCCCCCCACCGG + Intronic
1162332234 19:10037494-10037516 CACCCCCAACTCCGCCCCATTGG + Intergenic
1163521637 19:17795243-17795265 CACCCCCAAACCCCCACCACTGG - Intronic
1163977581 19:20866925-20866947 CACCCACAAATTCACAACAGTGG + Intergenic
1165669441 19:37662991-37663013 CACCACCAAGTCCCCAGCACAGG - Intronic
1167112760 19:47471756-47471778 CGCCCCCACCTCCCCACCAATGG + Intronic
1167991881 19:53367150-53367172 CACCCCCACCTCCAGAACAAGGG - Intronic
1168078156 19:53991728-53991750 CACCCCCGACTCCCGAGCAGGGG - Intergenic
926976675 2:18522785-18522807 CACCTCCAAATCCCCACCAGTGG + Intergenic
932063517 2:68529749-68529771 CACCCCCAACAGCCCCACGGGGG - Intronic
932337165 2:70937994-70938016 CACACCAAACAACCCAACAGTGG + Intronic
933074693 2:77908112-77908134 CATCCCCAACCCACCAACTGTGG + Intergenic
933945409 2:87281979-87282001 CATCTCCAACTCCACACCAGAGG - Intergenic
934892949 2:98086932-98086954 CACCCCAGACCCCCAAACAGAGG - Intergenic
935200844 2:100855266-100855288 AACCCCCAACACTCAAACAGGGG - Intronic
935680949 2:105636439-105636461 CCCTCCTCACTCCCCAACAGTGG + Intergenic
936155358 2:110043261-110043283 CCCCCCCAACACCCCCACAAAGG - Intergenic
936189322 2:110328152-110328174 CCCCCCCAACACCCCCACAAAGG + Intergenic
936334801 2:111579611-111579633 CATCTCCAACTCCACACCAGAGG + Intergenic
937319306 2:120951437-120951459 CACACCCTACTCACCATCAGCGG - Exonic
937835295 2:126465464-126465486 CCCCGCCAACTCACCAAAAGTGG + Intergenic
938575001 2:132595529-132595551 CACCCCCACATCCCCACCACTGG + Intronic
940173084 2:150849764-150849786 CAACCCCAAAGCCCCAAAAGGGG + Intergenic
941678718 2:168371869-168371891 CACCCCCAACTCCAGAACAGAGG + Intergenic
945309594 2:208295968-208295990 CACCCAAAACTCTCCAACAACGG - Intronic
947533183 2:230925568-230925590 CACCCCAGACACCCTAACAGGGG + Intronic
948604002 2:239123364-239123386 CACCCCCAAGCCCTCATCAGCGG - Intronic
1168848429 20:960553-960575 CCCCACCCACTCCCCAACAACGG + Intronic
1170456926 20:16542079-16542101 CTACACCAACTCCCCAGCAGAGG + Intronic
1172115653 20:32572026-32572048 CACACCCAACTCCCCAGCCTGGG + Intronic
1173073533 20:39794083-39794105 CTCCCCCAACTCCACACCACTGG - Intergenic
1174078486 20:47954546-47954568 CTTCCCCAATTCCCCAGCAGAGG - Intergenic
1174187763 20:48719307-48719329 CCCCCCCAACTCCCCAACAAGGG + Intronic
1175127497 20:56763373-56763395 GGCCCCCAGCTCCCAAACAGAGG - Intergenic
1175994396 20:62805592-62805614 CAATCCCAGCTCCCCGACAGGGG - Intronic
1176378806 21:6101566-6101588 GACCCCCACCTCCCCAGCATGGG + Intergenic
1178268760 21:31169737-31169759 CCCCCTCAACTCCCCAAAAAAGG + Intronic
1178821483 21:35978955-35978977 CACCCACAACTGCCCCACATAGG + Intronic
1178920082 21:36733016-36733038 CAGCCCCTCCGCCCCAACAGTGG - Intronic
1179053972 21:37914884-37914906 CATCTCCAACTCCCAAACACTGG + Intronic
1179744668 21:43436671-43436693 GACCCCCACCTCCCCAGCATGGG - Intergenic
1179986420 21:44923537-44923559 AAGCCCCATGTCCCCAACAGTGG - Intronic
1181387563 22:22557352-22557374 CAGCCACAACTCCTCAACTGGGG + Exonic
1183732139 22:39624452-39624474 CTCCCCCAACTGCCCAGCGGTGG - Intronic
1185067813 22:48640793-48640815 CACCAACACCTCCCCAACTGGGG - Intronic
1185224943 22:49647056-49647078 CACCCCCAAGTCCCCGTGAGTGG + Intronic
952764481 3:36943186-36943208 CTCCCCCCACCCCCCACCAGAGG - Intronic
952889355 3:38030197-38030219 CACCCCCAACACTCCACCAAAGG - Intergenic
954177458 3:48855870-48855892 CAGCCCCAACTCCCAGATAGGGG + Intergenic
954626015 3:52022280-52022302 CACCCCCAACGCCCCCACTATGG + Intergenic
954870938 3:53767004-53767026 CATCCCCATCTCCCCTACAAGGG - Intronic
955371021 3:58352117-58352139 CAGCCACAAGTCCCCAGCAGGGG - Intronic
955445643 3:59007154-59007176 CACCCCCAACTCCCCAACAGTGG + Intronic
957074481 3:75590857-75590879 CACTCCCAATCCCCCAACACAGG - Intergenic
957754340 3:84467290-84467312 CATTCCCAACTCCCTCACAGTGG - Intergenic
958016860 3:87947688-87947710 CACCCCAAAATCCTCCACAGTGG - Intergenic
961279619 3:125755862-125755884 CACTCCCAATCCCCCAACAAAGG + Intergenic
961348587 3:126282657-126282679 CACCCCCAACCTCCAAAGAGGGG + Intergenic
961860911 3:129916472-129916494 CACCCCCCATTCCCCACCAAGGG + Intergenic
961874778 3:130013740-130013762 CACTCCCAATCCCCCAACACAGG - Intergenic
961913512 3:130345917-130345939 CGCCCCCAACTCTCCAGAAGAGG - Exonic
962406030 3:135100910-135100932 CACCCCCAACTTCAGAAAAGGGG - Intronic
962862204 3:139414588-139414610 CACCCCCACATCCCCTACAGGGG - Intergenic
962935190 3:140074289-140074311 CTCCCCCCACCCCCCAACAGTGG + Intronic
963960074 3:151299989-151300011 CTCCCCAAATTCCCAAACAGTGG + Intronic
965792025 3:172399756-172399778 CTTCCCCAACCCCCCAAGAGGGG - Exonic
967250298 3:187530424-187530446 CACCCCTAAATCCACAGCAGTGG + Intergenic
968473188 4:791297-791319 CGGCCCCCACTCCCCATCAGCGG + Intronic
968511668 4:998335-998357 CACCCCCAGCTCCACAGCAAAGG - Intronic
968727691 4:2255892-2255914 CACCCCCAGCTCCCCGGCAGCGG - Intronic
968921351 4:3523843-3523865 CACCCCCACCCCCACCACAGTGG + Intronic
968987118 4:3881528-3881550 CACTCCCAATCCCCCAACACAGG - Intergenic
971615666 4:28788024-28788046 CACCCCCAACCCCACAATAAAGG - Intergenic
975094500 4:70442439-70442461 CCTCCCCACCACCCCAACAGTGG + Intronic
976495615 4:85726225-85726247 CACCCCCCACCCCCCAAAAGAGG - Intronic
976600616 4:86934921-86934943 CACCCCCACCTCCCGAGCTGCGG - Intronic
980550433 4:134327970-134327992 CACCGCCAACTCCCCATTGGCGG - Intergenic
982598205 4:157412729-157412751 CACCCCCAACAGCACCACAGTGG + Intergenic
983894565 4:173068334-173068356 CACCCCTCCATCCCCAACAGTGG - Intergenic
984275712 4:177607199-177607221 CACCCCCCACCCCCCCACCGTGG - Intergenic
985089421 4:186348349-186348371 CACCCCCTACTCCCATCCAGAGG + Intergenic
985701522 5:1376083-1376105 CACCCCCTTCTCCCACACAGTGG + Intergenic
986352913 5:6896555-6896577 CACTCCCACCCTCCCAACAGAGG + Intergenic
986523381 5:8645430-8645452 CTCCCCCCACCCCACAACAGGGG - Intergenic
986723960 5:10580683-10580705 CACCCCCGACACCCCACCAAAGG - Intronic
987064283 5:14273086-14273108 CACCCCCAAGCCCCCAGCACTGG + Intronic
988554137 5:32221819-32221841 CACCACCACCTCCCCAGCAGTGG + Intergenic
989302675 5:39912354-39912376 CACCCCCCACCCCCCAACCATGG - Intergenic
991639795 5:68740854-68740876 TACCTCCAACCCCCCAACAAAGG - Intergenic
991660521 5:68946134-68946156 CACCCAAAACTCCCCACCTGAGG - Intergenic
995911077 5:117187483-117187505 CACAGCCAACTGTCCAACAGTGG - Intergenic
998058018 5:139096074-139096096 AACGCCCACCCCCCCAACAGTGG + Intronic
1002073189 5:176692823-176692845 CACCCCCAGCTCCTGAGCAGGGG + Intergenic
1002575726 5:180172690-180172712 CACGCCCAGCTCCCCAAGAGGGG + Intronic
1004915362 6:20327257-20327279 CATACCCAAATGCCCAACAGTGG + Intergenic
1006406972 6:33851129-33851151 CCCCCCCCACACCCCAAGAGTGG - Intergenic
1007790688 6:44306579-44306601 CACCCCCACCTCCCCACCCTGGG + Intronic
1008262226 6:49381090-49381112 CTTCCGCAACTCCCCAACAGAGG + Intergenic
1008520229 6:52356100-52356122 GACCCCCAGCTGTCCAACAGAGG + Intergenic
1009398812 6:63230622-63230644 CACCTCCAACAGCCCCACAGGGG - Intergenic
1010233839 6:73558742-73558764 CACCCCCACCTGCCCTCCAGAGG - Intergenic
1012626717 6:101413265-101413287 CACCCCCAACACACAAAGAGAGG - Intronic
1016514033 6:144873868-144873890 CACCCCCAACCACCAACCAGAGG + Intergenic
1017187420 6:151616224-151616246 CAGCCCCAAATCTCAAACAGTGG + Intronic
1017747923 6:157463495-157463517 CACCCCCAACTCTTCACCAGAGG + Intronic
1019556469 7:1633927-1633949 CACCCCCAAGTCCCCCACCAGGG - Intergenic
1019732243 7:2634585-2634607 CACCCCCAACTCCCAACCCCAGG - Intronic
1022528673 7:31053604-31053626 CACCCCCATCTTCCAAAAAGGGG - Intronic
1024199124 7:47088664-47088686 CACACCACACTCCCCAACACAGG + Intergenic
1024307355 7:47939833-47939855 CAGCCCCCACTCCCCACCTGAGG + Intronic
1024307383 7:47939909-47939931 CAGCCCCCACTCCCCACCTGAGG + Intronic
1024536791 7:50441664-50441686 CACCACCAGCTCCCCAACTAAGG + Intergenic
1025262591 7:57429440-57429462 AATCCCTAACTCCCCTACAGTGG - Intergenic
1026798005 7:73378080-73378102 CACCCCCACATCCCCAACCCCGG + Intergenic
1029076533 7:97939008-97939030 CACTCCCAATCCCCCAACACAGG - Intergenic
1029654855 7:101917536-101917558 GGCCCCCCACTCCCCAACACTGG - Intronic
1030838544 7:114319147-114319169 CCCCCCCAACCCCCCATCACAGG - Intronic
1032574366 7:133036476-133036498 TACCCCCAACACCCACACAGTGG - Intronic
1035271197 7:157720967-157720989 CACACCTACCTCCCCAACATGGG - Intronic
1035641008 8:1185090-1185112 CTGCCCCAACACCCCAAGAGAGG - Intergenic
1037801242 8:22037058-22037080 CACCCCCAATTCTCCCCCAGTGG + Intergenic
1037880654 8:22571893-22571915 CTCCCCCAAGTCCCCACCTGTGG + Intronic
1037902210 8:22694800-22694822 CAACCCCGACTCCCCAGGAGGGG - Intergenic
1038373199 8:27012657-27012679 CACCCCCAACAGCCCCACAGGGG - Intergenic
1039406634 8:37318615-37318637 CACCCCAAACATCCCAGCAGTGG - Intergenic
1042154142 8:65823142-65823164 CACCCTCTTCTCCCCATCAGTGG - Intronic
1043501895 8:80866706-80866728 CCCCCCCAACCCCGCAAGAGGGG - Intronic
1043555067 8:81421087-81421109 AACCCACAACTACCCAACTGAGG - Intergenic
1045008037 8:97932940-97932962 CAGCACCAACTCCCCAGGAGAGG + Intronic
1045778450 8:105835024-105835046 CATCCTCACCTCCCCAATAGTGG + Intergenic
1045887620 8:107118041-107118063 CATCCCCACTTCCCCAGCAGAGG + Intergenic
1046448679 8:114358986-114359008 CACCCCTCCATCCCCAACAGTGG + Intergenic
1046793115 8:118342889-118342911 CACCACCAACTCCTCAAAGGAGG - Intronic
1047219871 8:122910728-122910750 CACCCCCCACCCCCCAGCAGGGG - Intronic
1048371710 8:133784253-133784275 CTACCCCAAATCCCCCACAGTGG - Intergenic
1048919534 8:139215349-139215371 CACCCCCTTCTCCAGAACAGTGG - Intergenic
1049625376 8:143617487-143617509 CACCGCCGGCTCCCCGACAGCGG + Exonic
1051565828 9:18496989-18497011 CACCCTCCACTCCCCAAAACAGG - Intronic
1051861298 9:21627768-21627790 CACCCCCTACCCCCCAAAAAAGG + Intergenic
1052413143 9:28147678-28147700 CACCCCCAACAGCCCCACGGGGG + Intronic
1055987193 9:82063610-82063632 CACCCCCAGCTCCACACCATGGG - Intergenic
1056583711 9:87914572-87914594 CACCCCCAGCTCCACACCATGGG + Intergenic
1056584203 9:87918041-87918063 CACCCCCAGCTCCACACCATGGG + Intergenic
1056612666 9:88134884-88134906 CACCCCCAGCTCCACACCATGGG - Intergenic
1056613163 9:88138374-88138396 CACCCCCAGCTCCACACCATGGG - Intergenic
1057071426 9:92103892-92103914 CACCCCCAACAGCCCCACAGGGG + Intronic
1057159981 9:92882651-92882673 CACCCCCAGCTCCACACCATGGG + Intergenic
1057237176 9:93370991-93371013 CACCCACTACTTCCCAACACTGG + Intergenic
1057826771 9:98377761-98377783 CACCCCCAACTCCCTTCCAGAGG - Intronic
1058578048 9:106424686-106424708 CATCCCCAAAGTCCCAACAGAGG + Intergenic
1059329491 9:113525874-113525896 CACCCCCAGCTCCCGAACTGAGG - Intronic
1059907143 9:119000342-119000364 CACCACCAACACCCCACCACTGG - Intergenic
1059986604 9:119826172-119826194 CACCCCAAACTTCCCAATAACGG + Intergenic
1060489674 9:124073501-124073523 CACTCCCAACTCCTCAAAGGTGG - Intergenic
1060748115 9:126151038-126151060 CACTCCCACCTCCCCAGGAGAGG - Intergenic
1061969165 9:134034652-134034674 CACCCCCCACCCCCCTAAAGAGG + Intronic
1062060578 9:134493205-134493227 CACCCCCATCCCCCAAACACCGG - Intergenic
1062393142 9:136341998-136342020 CACCCCCAATTTCCCAGGAGAGG - Intronic
1062564307 9:137157114-137157136 CCCGCCCACCTCCCCAAGAGCGG - Intronic
1062564326 9:137157183-137157205 CTCCCCCAGCTCCCTAAGAGCGG - Intronic
1189663403 X:43327344-43327366 CACCCCCTCATCCCCTACAGTGG - Intergenic
1190797763 X:53760323-53760345 CACCCCCACCTCTCCAATGGGGG - Intergenic
1190917393 X:54820891-54820913 CACCCCCACCTCTCCAATGGGGG + Intergenic
1191249869 X:58255152-58255174 GACCCCCAAGGGCCCAACAGAGG + Intergenic
1191880553 X:65840579-65840601 CCCTCCCAACTCCCCAGCAGTGG + Intergenic
1192171966 X:68861317-68861339 CACCTCTAACTCCCCACCACAGG - Intergenic
1193690399 X:84634616-84634638 CACACCCCTATCCCCAACAGAGG + Intergenic
1195081621 X:101376725-101376747 CACCCCCACCCCCCCACCAGAGG - Intronic
1195221002 X:102745638-102745660 CCGCCCCAACTCCCCAACCAGGG - Intronic
1195653684 X:107313589-107313611 CAATCCCAAGTCCCCAACAGAGG - Intergenic
1198264642 X:134998079-134998101 CTCCCCCTCCTCCTCAACAGAGG - Intergenic
1199950901 X:152705375-152705397 CACCCCCACCGCCCCCTCAGAGG + Intergenic
1199958781 X:152763086-152763108 CACCCCCACCGCCCCCTCAGAGG - Intergenic
1200155160 X:153971253-153971275 CACCCCCAAGTCCCCAGCACTGG + Exonic
1201764650 Y:17566025-17566047 CCCCCCCACCCCCCCAACTGTGG + Intergenic
1201836903 Y:18339965-18339987 CCCCCCCACCCCCCCAACTGTGG - Intergenic