ID: 955446910

View in Genome Browser
Species Human (GRCh38)
Location 3:59021630-59021652
Sequence GCAGCTACACAGATTGAACC TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 159
Summary {0: 1, 1: 0, 2: 0, 3: 7, 4: 151}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
955446906_955446910 18 Left 955446906 3:59021589-59021611 CCAAGGACCAATCCTGATTATTA 0: 1
1: 0
2: 0
3: 7
4: 115
Right 955446910 3:59021630-59021652 GCAGCTACACAGATTGAACCTGG 0: 1
1: 0
2: 0
3: 7
4: 151
955446908_955446910 6 Left 955446908 3:59021601-59021623 CCTGATTATTATTTCAAATCTCT 0: 1
1: 0
2: 2
3: 47
4: 491
Right 955446910 3:59021630-59021652 GCAGCTACACAGATTGAACCTGG 0: 1
1: 0
2: 0
3: 7
4: 151
955446905_955446910 29 Left 955446905 3:59021578-59021600 CCAATGATTGGCCAAGGACCAAT 0: 1
1: 1
2: 0
3: 17
4: 232
Right 955446910 3:59021630-59021652 GCAGCTACACAGATTGAACCTGG 0: 1
1: 0
2: 0
3: 7
4: 151
955446907_955446910 11 Left 955446907 3:59021596-59021618 CCAATCCTGATTATTATTTCAAA 0: 1
1: 0
2: 4
3: 45
4: 453
Right 955446910 3:59021630-59021652 GCAGCTACACAGATTGAACCTGG 0: 1
1: 0
2: 0
3: 7
4: 151

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
955446910 Original CRISPR GCAGCTACACAGATTGAACC TGG Intronic
900103716 1:973496-973518 GCAGCTGCACAGGCTGAGCCTGG + Exonic
901618298 1:10559904-10559926 GCAGCAACGCAGAGTGGACCAGG - Intronic
905033879 1:34904846-34904868 GCTTCTGCACAGAATGAACCAGG + Exonic
912059277 1:105645106-105645128 AAACCTACACAGATTGAACCAGG + Intergenic
915739036 1:158104107-158104129 TCAGCTCCCCAAATTGAACCAGG + Intergenic
916158715 1:161887163-161887185 GCAGGAGAACAGATTGAACCCGG - Intronic
916343294 1:163759567-163759589 GCAGCCTCAAAGATTGAAACTGG + Intergenic
916604752 1:166329993-166330015 GCAGCCACCCAGAGTCAACCAGG + Intergenic
917187006 1:172368910-172368932 CAAGCTACCAAGATTGAACCAGG + Intronic
924328011 1:242914863-242914885 GCTGCTACACAGATTTTTCCTGG + Intergenic
1066464104 10:35638975-35638997 TCAGATACACAGATTTCACCTGG - Exonic
1071047459 10:81399459-81399481 GCAGCTACAGAGATTAATCAAGG + Intergenic
1074080109 10:110161704-110161726 GCAGCTTCACACATTGACACCGG - Intergenic
1075214832 10:120523206-120523228 GCAGGAAAACAGCTTGAACCAGG + Intronic
1077033243 11:479771-479793 GCAGCAACACAGCCTGACCCAGG - Intronic
1077988525 11:7380137-7380159 GCAACAACACAGATGGAACTGGG + Intronic
1080634524 11:34111985-34112007 GCAGCTAAAGAGCTGGAACCAGG - Intronic
1084141008 11:67229289-67229311 TCAGCTTCACAGCTTAAACCAGG + Intronic
1085172927 11:74464079-74464101 GCAGGAACAGAGAGTGAACCTGG - Intronic
1086228229 11:84538176-84538198 GCAGCTTCTCAGTTTGAAACAGG + Intronic
1087121558 11:94580459-94580481 GCAGGTGCACAGATAGGACCTGG - Intronic
1087250341 11:95891977-95891999 GCAGCTACTCAGACTGAAGGTGG + Intronic
1088703399 11:112435343-112435365 GCACCAACATAGATAGAACCGGG + Intergenic
1091349821 11:134884164-134884186 GCAGGGACACAGATGGAGCCGGG - Intergenic
1091656862 12:2352475-2352497 GCAGCGACACAGAATTCACCTGG - Intronic
1096416113 12:51415452-51415474 CCACCTACCAAGATTGAACCGGG - Intronic
1097563274 12:61235354-61235376 CCACCTACCAAGATTGAACCAGG - Intergenic
1098175064 12:67781650-67781672 GCAGATAGTCAGATTTAACCAGG + Intergenic
1102852558 12:116262939-116262961 TCATCTGCACAGATTGAATCAGG - Intronic
1103230869 12:119329268-119329290 GCAGTTACACAGATAGGAGCAGG + Intergenic
1106121737 13:26865377-26865399 GCAGCTACATAGAAAGAGCCTGG + Intergenic
1108526863 13:51292940-51292962 GTAGCTGCACACCTTGAACCTGG - Intergenic
1111801992 13:92992690-92992712 TCAACTACACACATTGAACAGGG + Intergenic
1112306675 13:98280518-98280540 GCAGCTATACGGATTCAACAGGG - Intronic
1112412127 13:99173504-99173526 ACAGCTACACAGATTATATCAGG - Intergenic
1113918128 13:113886850-113886872 GCATCTCCAAAGACTGAACCTGG + Intergenic
1115212361 14:30980499-30980521 GCAGGAAAACAGCTTGAACCCGG - Intronic
1118031732 14:61824674-61824696 GCAGATAAACAGAATGAACTGGG - Intergenic
1119718655 14:76876349-76876371 TCAGTGACACAGATTGCACCAGG + Intergenic
1120177876 14:81314478-81314500 CCAGCAACAAAGAGTGAACCAGG + Intronic
1120422505 14:84305902-84305924 ACAGCTCCAAAGATTGAATCAGG + Intergenic
1125068895 15:35527997-35528019 GCATCATAACAGATTGAACCTGG - Intronic
1126826114 15:52550047-52550069 GCAGGTATACTGATGGAACCAGG + Exonic
1127802113 15:62485750-62485772 ACAGACACACAGATTGAGCCAGG - Intronic
1130092255 15:80830801-80830823 GCAGAACCACAGCTTGAACCAGG - Intronic
1135898095 16:26428853-26428875 GCAGCAACATAGATGGAACTGGG + Intergenic
1142396520 16:89834985-89835007 GCAGGTTCACAGATTCACCCGGG - Intronic
1142798469 17:2328147-2328169 GCAGGAAAACTGATTGAACCTGG + Intronic
1143431275 17:6887543-6887565 CAACCTACCCAGATTGAACCAGG - Intronic
1144005800 17:11097823-11097845 GCAGCTATATGGATTGAGCCAGG - Intergenic
1147183313 17:38700509-38700531 GGAGATACACAGATAGCACCTGG - Intergenic
1149253280 17:54794744-54794766 GCAGCTGCACAGATAGAAAGGGG - Intergenic
1151881351 17:76897028-76897050 CCAGCTACTCAGATTGAGGCAGG - Intronic
1156182911 18:34626768-34626790 GAAGCTACACAGATGCAGCCTGG + Intronic
1157220893 18:45828001-45828023 GCTGCTTCACAGTTAGAACCAGG + Intronic
1158448644 18:57543414-57543436 GCAGAAACACAGAGTGAACCAGG + Intergenic
1160621040 18:80170842-80170864 GCAAGTGCACAGATTGGACCTGG - Exonic
1161655015 19:5508882-5508904 GCTGAAACTCAGATTGAACCCGG - Intergenic
1161895600 19:7077227-7077249 GCAGGAGAACAGATTGAACCTGG - Intronic
1163307746 19:16492360-16492382 GCAGCTGAACTGTTTGAACCTGG + Intronic
1166015479 19:39976306-39976328 CCAGCTACTCAGCGTGAACCCGG + Intronic
1166422851 19:42652226-42652248 GCAGCCACAGAGACTGAAACTGG + Intronic
1166622719 19:44316970-44316992 GCAGCAACATGGATGGAACCGGG - Intergenic
927309491 2:21613735-21613757 TAACCTACTCAGATTGAACCAGG - Intergenic
927524065 2:23721306-23721328 GCAGCTCCACGGATTGCCCCTGG + Intergenic
928749188 2:34451998-34452020 AAACCTACAAAGATTGAACCAGG - Intergenic
930230396 2:48837368-48837390 CAACCTACCCAGATTGAACCAGG - Intergenic
930294721 2:49540696-49540718 CCACCTACCAAGATTGAACCAGG + Intergenic
930363831 2:50413875-50413897 GCAACAACACAGATGGAACTGGG + Intronic
935889775 2:107663718-107663740 GCAGTTACACAGATATAAGCAGG + Intergenic
936846235 2:116838192-116838214 GCAGGAAAACCGATTGAACCTGG - Intergenic
937032946 2:118756022-118756044 GCTGCTACACAGATTGAATGAGG - Intergenic
938486604 2:131716897-131716919 ACAACTACCAAGATTGAACCAGG - Intergenic
939601822 2:144201807-144201829 TCAACTACACATATTCAACCAGG + Intronic
944214334 2:197239023-197239045 GCAGCAAGACAGATGGAACCTGG - Intronic
945450727 2:209992170-209992192 GCAAGTATACAGAGTGAACCTGG + Exonic
946377529 2:219321722-219321744 GCAGGAACACTGATTGAGCCTGG - Intergenic
1173863330 20:46298140-46298162 GCAGCTAGACAGATTGAGGTTGG - Intronic
1178777468 21:35565860-35565882 ACAGCTCCACAGACTCAACCAGG + Intronic
1182393965 22:30021990-30022012 ACAGCTGAACAGAATGAACCTGG - Intronic
1184102108 22:42346177-42346199 GCAGCTAAACACATGGACCCTGG + Intergenic
1185060224 22:48602818-48602840 TGAGCTTCACAGATGGAACCTGG + Intronic
1203274634 22_KI270734v1_random:79212-79234 GCAGCTGCACAGAGGGAAGCAGG - Intergenic
951652936 3:24972283-24972305 GCAGCAACACAAATCGAACTGGG - Intergenic
953793954 3:45968550-45968572 GCAGCTGGACAGAGAGAACCAGG - Exonic
955446910 3:59021630-59021652 GCAGCTACACAGATTGAACCTGG + Intronic
964752536 3:160065526-160065548 GCAGTGACACAGAATAAACCTGG - Intergenic
964884149 3:161461287-161461309 TAACCTACAAAGATTGAACCAGG - Intergenic
965026458 3:163307770-163307792 CCATCTACCAAGATTGAACCAGG + Intergenic
967024880 3:185556054-185556076 GCAAGTACACTGATTGAACAGGG - Intergenic
967126377 3:186428074-186428096 GCAGGTCCACAGAGTGAACAGGG - Intergenic
967368863 3:188720004-188720026 GCAGGAGCACAGCTTGAACCTGG - Intronic
967461340 3:189750165-189750187 GCAGCTACATGGATGGAACTGGG + Intronic
968864156 4:3197067-3197089 GCAGCTCCACAGAATCAAGCTGG - Intronic
969099352 4:4757192-4757214 TCAGCTGCCCAGATTCAACCTGG - Intergenic
971148076 4:24001317-24001339 GGTGCTACACAGATTCAACGTGG - Intergenic
971397602 4:26243131-26243153 GCAGGAAAACAGCTTGAACCCGG + Intronic
973538231 4:51906267-51906289 GCAGCCACACAGGTTCAAGCTGG + Intronic
974130406 4:57747864-57747886 GCAGCCTCAAAGATTGAAGCTGG - Intergenic
975695150 4:77005666-77005688 CCAGCTACTCACAATGAACCAGG + Exonic
978281734 4:107024933-107024955 GCATATACCCAGATTGAACATGG + Intronic
978405697 4:108376590-108376612 GCAGCTACGCAGACTGAGCAAGG - Intergenic
980456427 4:133049704-133049726 CCACCTCCAAAGATTGAACCAGG + Intergenic
981241162 4:142477705-142477727 ACAGCTTCCAAGATTGAACCAGG + Intronic
981275679 4:142896154-142896176 ACAGCCCCCCAGATTGAACCAGG - Intergenic
990627845 5:57634487-57634509 GCAGCTTCACAGACTGGATCAGG - Intergenic
990959419 5:61378647-61378669 GCAGGAAAACCGATTGAACCTGG - Intronic
990975155 5:61553594-61553616 GCAGCAACACAGCTGGAACTGGG - Intergenic
992147910 5:73870660-73870682 GCAGCTACTCACACTGCACCTGG - Intronic
992634913 5:78718111-78718133 GCAGGTGCACAGTTGGAACCTGG + Intronic
992802985 5:80310196-80310218 GCAGCTGCAGAGAGTGAGCCAGG - Intergenic
992959790 5:81946957-81946979 GCAGGAAAACAGCTTGAACCTGG - Intergenic
994428399 5:99624214-99624236 ACAACTACCAAGATTGAACCAGG - Intergenic
996445214 5:123540724-123540746 GCAGCAAAATCGATTGAACCTGG - Intronic
1000698692 5:164421599-164421621 TCAGCTACAAAGATAGACCCTGG - Intergenic
1000724860 5:164757249-164757271 GGAGCTACACAGAATAAAGCTGG - Intergenic
1003146337 6:3513419-3513441 GCAGGTACACAGAAGGAGCCAGG + Intergenic
1003198818 6:3939868-3939890 TCAGCTCCACAGATGGAGCCTGG - Intergenic
1003711323 6:8594023-8594045 GCAGCAACACAGATGGAACTGGG + Intergenic
1014594358 6:123314690-123314712 GCAGTGACACAGATGGAACAAGG + Intronic
1016251835 6:142052420-142052442 CCATCTACCAAGATTGAACCAGG + Intergenic
1019021684 6:168923895-168923917 GCAGCAAAACCGTTTGAACCTGG - Intergenic
1027402111 7:77820257-77820279 ACACCTACCAAGATTGAACCAGG - Intronic
1030026853 7:105332669-105332691 GCAGGAAGACAGCTTGAACCTGG + Intronic
1031603462 7:123741821-123741843 GCAGCAAAACAAATAGAACCCGG + Intronic
1032882887 7:136108513-136108535 CAAGCTACCAAGATTGAACCAGG - Intergenic
1033638395 7:143235229-143235251 TAACCTACAAAGATTGAACCAGG - Intergenic
1034412542 7:150948800-150948822 GCAGCCACACAGCTGGAAGCAGG + Intronic
1036135063 8:6152856-6152878 GCAGCTGCAGAGAGTGCACCAGG + Intergenic
1037006820 8:13791625-13791647 GCAGCTACAGTGAGTAAACCTGG - Intergenic
1037010943 8:13841670-13841692 GCAGCTACACCAATAGAACAGGG + Intergenic
1041207889 8:55516972-55516994 GCAGCAACATAGATGGAACTGGG + Intronic
1043233190 8:77829058-77829080 AAACCTACCCAGATTGAACCAGG - Intergenic
1043263691 8:78234847-78234869 GCAGTTACACAGATAAAAGCTGG - Intergenic
1045845518 8:106630882-106630904 GCAGCAACACAGCATGAAGCAGG - Intronic
1045894607 8:107199676-107199698 CCAGCTACAGAGATGGAGCCTGG + Intergenic
1047525899 8:125633786-125633808 GCAGCTTCAAAGCTGGAACCTGG + Intergenic
1048374441 8:133810699-133810721 GAAGCTACACAGATTCAGCAAGG + Intergenic
1048705921 8:137153932-137153954 GCAACAACACAGATGGAACTGGG - Intergenic
1048881186 8:138874049-138874071 GCAGCTAGTGAGATTGAATCAGG - Intronic
1053272902 9:36762525-36762547 GCAGGTAAACAGCTTGAAGCTGG + Intergenic
1055811366 9:80152063-80152085 CAAGCTCCAAAGATTGAACCAGG - Intergenic
1056988071 9:91383492-91383514 CTAGGTACACAGATTAAACCCGG - Intergenic
1059990775 9:119863257-119863279 GGAGATACAGAGATTGAACAAGG + Intergenic
1061203353 9:129149571-129149593 GCAGCTGCTCAGTTTGAACTCGG - Intergenic
1187653649 X:21442846-21442868 GCAGCAACACAGATGGAGCTTGG + Intronic
1188092286 X:25977760-25977782 GCAGCCGCAAAGATTGAAACTGG + Intergenic
1189448878 X:41108483-41108505 GCAGCTTACCAGATAGAACCAGG - Intronic
1193089917 X:77482802-77482824 GCAGCTTCAAAGATTGAAGGAGG + Intergenic
1193380270 X:80809440-80809462 GCACCTACCCAGATCGAAGCCGG - Exonic
1194612911 X:96065141-96065163 CAACCTACACAGATTGAACCAGG - Intergenic
1195645642 X:107228075-107228097 GCAGATTCACAGATTGACCTTGG + Intronic
1196624130 X:117858695-117858717 GCAGCTACACAGCCAGAACCAGG - Intergenic
1197166404 X:123382343-123382365 ACAGCAGCACAGATTAAACCAGG - Intronic
1198624014 X:138548584-138548606 TCAGATACATAGGTTGAACCTGG - Intergenic
1198982264 X:142412336-142412358 AAACCTACAAAGATTGAACCAGG + Intergenic
1199228570 X:145408851-145408873 GCAGTTACCCAGGTTGAAACAGG + Intergenic
1201510872 Y:14761050-14761072 GGAGCTATACTGATTGAAACAGG + Intronic
1201549023 Y:15199469-15199491 GCAGCAAGACAGATGGAACTGGG + Intergenic