ID: 955447049

View in Genome Browser
Species Human (GRCh38)
Location 3:59023619-59023641
Sequence CCCACAAAGTTGGTGGTCAC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 140
Summary {0: 1, 1: 0, 2: 0, 3: 9, 4: 130}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
955447049_955447058 30 Left 955447049 3:59023619-59023641 CCAGTGACCACCAACTTTGTGGG 0: 1
1: 0
2: 0
3: 9
4: 130
Right 955447058 3:59023672-59023694 AAATCCTAATTTTTTTCCTACGG 0: 1
1: 1
2: 3
3: 52
4: 619
955447049_955447055 -1 Left 955447049 3:59023619-59023641 CCAGTGACCACCAACTTTGTGGG 0: 1
1: 0
2: 0
3: 9
4: 130
Right 955447055 3:59023641-59023663 GGCAACTGGATAAAGCAGCTTGG 0: 1
1: 0
2: 1
3: 10
4: 163
955447049_955447057 7 Left 955447049 3:59023619-59023641 CCAGTGACCACCAACTTTGTGGG 0: 1
1: 0
2: 0
3: 9
4: 130
Right 955447057 3:59023649-59023671 GATAAAGCAGCTTGGGCTGCAGG 0: 1
1: 0
2: 2
3: 16
4: 182
955447049_955447056 0 Left 955447049 3:59023619-59023641 CCAGTGACCACCAACTTTGTGGG 0: 1
1: 0
2: 0
3: 9
4: 130
Right 955447056 3:59023642-59023664 GCAACTGGATAAAGCAGCTTGGG 0: 1
1: 0
2: 0
3: 10
4: 158

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
955447049 Original CRISPR CCCACAAAGTTGGTGGTCAC TGG (reversed) Intronic
904577176 1:31512518-31512540 CCCACAAAATTTGTGTCCACTGG - Intergenic
906574518 1:46875817-46875839 CCCCCAGAGGTGGAGGTCACTGG + Intergenic
906597455 1:47092088-47092110 CCCCCAGAGGTGGAGGTCACTGG - Intronic
908069865 1:60448316-60448338 CCCAGAACATTGGTTGTCACTGG + Intergenic
915666694 1:157451528-157451550 CCCACGAAGTTGCTGTTCCCTGG - Intergenic
923018487 1:230145303-230145325 CCCACAAACTTAGGGGTCAGGGG - Intronic
923495937 1:234524798-234524820 CCCACAAGGATGGTAGTTACAGG + Intergenic
1063044115 10:2373966-2373988 CCCACAAAGTTGCAGCTCTCTGG + Intergenic
1064712985 10:18145326-18145348 TCTCCAAAGTTGGTGGTTACAGG + Intronic
1068067255 10:52147574-52147596 CCAACAAAGTAAGTGGTAACTGG + Intronic
1072022386 10:91415036-91415058 TCCACTAAGGTGGTGGCCACAGG + Intronic
1074753961 10:116610857-116610879 TCCACAGAGATGGTGGTTACAGG + Intergenic
1076598267 10:131639114-131639136 CACACAAAGCTGGGGCTCACAGG + Intergenic
1077863543 11:6204157-6204179 CCCACAAAGTTGGCTGTCATCGG - Intergenic
1078468929 11:11571517-11571539 ACCAGAAAGCTGGTGTTCACTGG - Intronic
1083230485 11:61314801-61314823 GCCAAAAAACTGGTGGTCACAGG - Intronic
1084274191 11:68043357-68043379 GCCACAAAGCTGGCGGCCACGGG - Exonic
1089041151 11:115451463-115451485 CTCACAAAGTAGGAGGTCCCAGG + Intronic
1092337081 12:7642639-7642661 CCCCCAGAGGTGGAGGTCACTGG + Intergenic
1094245836 12:28291543-28291565 CACAAAAAGTTCATGGTCACTGG - Intronic
1096494953 12:52034404-52034426 CCCACAATGTGGGGCGTCACTGG + Intronic
1101492423 12:105222059-105222081 ATCACAAAGCTGGCGGTCACGGG + Intronic
1102415505 12:112759004-112759026 CCCACACAACTTGTGGTCACTGG + Intronic
1105377475 13:19858899-19858921 CCCATCAAGTTGATGGTGACAGG + Intronic
1108215361 13:48178561-48178583 CCCAGACATTTGGAGGTCACTGG - Intergenic
1112174576 13:97009462-97009484 CCCACAAAGCTAAGGGTCACTGG - Intergenic
1114847223 14:26337794-26337816 CCCACAAAGAGGGTGATCAAAGG - Intergenic
1125427896 15:39567979-39568001 CCAACTAAGTGGGTGGACACTGG + Intergenic
1128667118 15:69546786-69546808 TCCACAAAGCTGGTTGTCCCAGG - Intergenic
1129107058 15:73317818-73317840 CCCAAAAGGTTGGTGCTCCCTGG - Intergenic
1130742885 15:86620127-86620149 TCCACAAAATTGGTGGTGTCAGG + Intronic
1131015397 15:89053588-89053610 CCCTCAAAGAAGGTGGACACAGG + Intergenic
1132013929 15:98299764-98299786 CCCTCAGATTTGGTGGGCACAGG - Intergenic
1138071879 16:54000666-54000688 ACCACAGGGTTGGTTGTCACTGG - Intronic
1138523724 16:57589411-57589433 CCCAAAAGGTTGGGGATCACTGG + Intronic
1139471648 16:67181047-67181069 CCCACCTAGGTGGTGGTTACTGG + Intronic
1140575189 16:76159268-76159290 CACAGAAAGTTGGTGGACATAGG - Intergenic
1141423933 16:83933585-83933607 GCCACTTAGTTTGTGGTCACTGG - Intronic
1144404875 17:14942555-14942577 CCCACAAAGTAGGTGCTCCAAGG - Intergenic
1146749391 17:35364235-35364257 CCCCTAAAGTTGGTGTTCACTGG - Intronic
1154027723 18:10724169-10724191 CCCACCTAGATGGTGGTTACTGG - Intronic
1154442128 18:14399540-14399562 CCAACATATTTGGTGGTAACTGG + Intergenic
1155935098 18:31745446-31745468 CCCTCAAAGTTGGTGGTAAACGG + Intergenic
1157684325 18:49630506-49630528 CCCACAAGGCTCCTGGTCACAGG - Intergenic
1163194019 19:15701945-15701967 CTAACACAGGTGGTGGTCACAGG + Intergenic
1164667899 19:30053584-30053606 TCCGCAGAGTAGGTGGTCACTGG + Intergenic
1165073871 19:33270117-33270139 CCCACAAAGCCTGGGGTCACTGG + Intergenic
1166438727 19:42791794-42791816 CTCCCAGAGTTGGAGGTCACTGG - Intronic
1166590360 19:43992354-43992376 TCCACTAAGTTTGTGGTCATTGG - Intronic
1166682004 19:44774306-44774328 CCCACCAAGTTCATGTTCACTGG - Intergenic
1166684031 19:44784474-44784496 CCCTCAAACGTGGTGGCCACCGG - Intronic
929476087 2:42250670-42250692 CCAAAAAAGTTGGTGACCACTGG - Intronic
930691717 2:54371748-54371770 CCCACAATGTGGGTGGGCACAGG + Intronic
931143446 2:59489101-59489123 CCCACAATGTTTCTGGTCAAAGG - Intergenic
931229245 2:60360187-60360209 CCCTCAAAGGTAGTGGTCCCAGG - Intergenic
931911109 2:66901347-66901369 CCATCAAAGTTGATGGTCAGTGG - Intergenic
934973183 2:98780031-98780053 CCCACAAAGTGTGTGACCACTGG - Intergenic
935328371 2:101958801-101958823 CCAACAAATATGGTGTTCACTGG + Intergenic
935563103 2:104578520-104578542 CCCTCAAAGTTCATGTTCACTGG - Intergenic
937016500 2:118610901-118610923 ACCCCAAAGTGGGTGGGCACAGG - Intergenic
937289396 2:120773112-120773134 ACCACAAAGTTGTTTGTCACAGG - Intronic
940131584 2:150388365-150388387 CGAACTCAGTTGGTGGTCACAGG - Intergenic
940989877 2:160086256-160086278 CCCCCAGAGATGGAGGTCACTGG - Intergenic
944221586 2:197309907-197309929 CCAACAAAGCTGGTAGACACAGG + Intronic
1173107355 20:40150576-40150598 CCCTCAAAGTTTGTGGCCTCTGG - Intergenic
1175190968 20:57211921-57211943 GCCACTAAGTTGGCGGTCACTGG + Intronic
1175778929 20:61670045-61670067 CCCCCAAAGGTGGTGCTGACAGG + Intronic
1175809117 20:61848120-61848142 CCCAGAAAGATGGGGATCACAGG + Intronic
1176000737 20:62830254-62830276 CCCCCAGAGTGGGTGGACACAGG - Intronic
1181273159 22:21672693-21672715 CCCACAAAACTGATGCTCACTGG - Intronic
1182626158 22:31648104-31648126 CACCCAAACTTGCTGGTCACTGG - Intronic
1184636119 22:45833242-45833264 CCCAGGAAGTCGGTGGTCAAGGG - Intronic
1184913873 22:47553677-47553699 ACCACCCAGTTGGTGGTCATTGG + Intergenic
1185180889 22:49362454-49362476 GCCACCAAGTTTGTGGTCATTGG - Intergenic
950264523 3:11564312-11564334 CCTGCACAGTTGATGGTCACAGG - Intronic
955447049 3:59023619-59023641 CCCACAAAGTTGGTGGTCACTGG - Intronic
963850268 3:150203986-150204008 ACCACAAAATTGGAGGTCACTGG + Intergenic
964997983 3:162911345-162911367 CCTACAAAGCTGCTGGTGACTGG + Intergenic
967466262 3:189809446-189809468 CCTACAAAGTTGGTTTTAACTGG + Intronic
969583952 4:8081302-8081324 CCCACGAGGCTGGTGGCCACGGG - Intronic
970343424 4:15130458-15130480 CTATCAAATTTGGTGGTCACAGG - Intergenic
971816586 4:31498542-31498564 ACCACAAATTTCGTGGTCCCGGG + Intergenic
973216980 4:47680427-47680449 CCCACAGTGATGGTGGTCAGTGG - Intronic
975517900 4:75267260-75267282 GCCACTAAGTTGCTGGTAACTGG + Intergenic
975800811 4:78057675-78057697 GCCGGAAAGTTGCTGGTCACTGG - Exonic
977610009 4:99021499-99021521 GCCACAAAATTGATGGGCACGGG + Intronic
978540977 4:109815998-109816020 CCCATCAGGTTGGTGGTCACTGG + Intronic
981033940 4:140151938-140151960 CCCCCAAAGTTGGCGGGCAGCGG + Intronic
982093592 4:151900313-151900335 CCCACCATCTTGGTGCTCACAGG + Intergenic
986367371 5:7046201-7046223 GCCACAACGTTGATGGCCACAGG - Intergenic
986785765 5:11112565-11112587 GCCACCAAGTTTGTGGTCATTGG + Intronic
995011075 5:107257898-107257920 CCCGTAAGGTTAGTGGTCACTGG - Intergenic
995421266 5:111969825-111969847 CCCAGAAAGCTGAGGGTCACTGG + Intronic
997607243 5:135183954-135183976 CCCAGACAGGTGGTGGTCTCAGG + Intronic
1004034968 6:11914976-11914998 GCCACAAAGTAGGTGCTCAGTGG + Intergenic
1016935346 6:149445610-149445632 CCCACATGGTTGGTGGTGGCTGG - Intergenic
1019554216 7:1620531-1620553 CCCAAAATGCTGGGGGTCACAGG + Intergenic
1022219508 7:28298826-28298848 CCCACCAAGATGATGATCACTGG + Intergenic
1024904652 7:54362733-54362755 CCCAGAAACTGGGTGGTCAGAGG + Intergenic
1025745678 7:64240590-64240612 CACACATAGTCAGTGGTCACTGG + Intronic
1025868214 7:65405828-65405850 CCCCCAGAGATGGAGGTCACTGG + Intergenic
1026895015 7:74005215-74005237 CCCAAAATGTTGGAGGTTACAGG + Intergenic
1030621804 7:111798213-111798235 CCCCCAGAGGTGGAGGTCACTGG + Intronic
1031631458 7:124048358-124048380 CCCACAAAGTTGCTTCTCCCTGG - Intergenic
1034633630 7:152550241-152550263 CCCATAAAGGTGGTGGTCCTAGG - Intergenic
1037098898 8:15018695-15018717 CCTACAAAGTTGGAAGCCACTGG + Intronic
1037835670 8:22213547-22213569 GCCACGGAGTTGGTGGTCAGTGG + Intergenic
1038535215 8:28348860-28348882 CCCACACAGGTGGTGGGCCCAGG + Intronic
1039118117 8:34115058-34115080 CCCAGAAGGTTGGTGGCCAAAGG + Intergenic
1041382087 8:57261021-57261043 CGCCCAAAGTTGGGGGTCCCTGG - Intergenic
1042131401 8:65589965-65589987 GACACAAAGTTGGTGTCCACTGG + Intergenic
1046224697 8:111262387-111262409 CCAACACAGATGGTGATCACAGG - Intergenic
1051051721 9:12941294-12941316 CACACATAAGTGGTGGTCACAGG - Intergenic
1054935076 9:70678119-70678141 TCCACAAGGTCGGTGGTCTCAGG - Intronic
1056766045 9:89445360-89445382 GCCACCCAGTTTGTGGTCACTGG - Intronic
1062073676 9:134572812-134572834 CACACACAGTAGGTGCTCACAGG - Intergenic
1062073702 9:134572962-134572984 CACACACAGTAGGTGCTCACAGG - Intergenic
1062073719 9:134573063-134573085 CACACAGAGTAGGTGCTCACAGG - Intergenic
1062073763 9:134573310-134573332 CACACACAGTAGGTGCTCACAGG - Intergenic
1062073806 9:134573557-134573579 CACACACAGTAGGTGCTCACAGG - Intergenic
1062073823 9:134573655-134573677 CACACACAGTAGGTGCTCACAGG - Intergenic
1062073842 9:134573753-134573775 CACACACAGTAGGTGCTCACAGG - Intergenic
1062073852 9:134573802-134573824 CACACACAGTAGGTGCTCACAGG - Intergenic
1062073879 9:134573950-134573972 CACACACAGTAGGTGCTCACAGG - Intergenic
1062073886 9:134574000-134574022 CACACACAGTAGGTGCTCACAGG - Intergenic
1062073915 9:134574147-134574169 CACACACAGTAGGTGCTCACAGG - Intergenic
1062073925 9:134574196-134574218 CACACACAGTAGGTGCTCACAGG - Intergenic
1062073933 9:134574246-134574268 CACACACAGTAGGTGCTCACAGG - Intergenic
1062073970 9:134574443-134574465 CACACACAGTAGGTGTTCACAGG - Intergenic
1062073997 9:134574592-134574614 CACACACAGTAGGTGCTCACAGG - Intergenic
1062074031 9:134574791-134574813 CACACACAGTAGGTGCTCACAGG - Intergenic
1062074049 9:134574889-134574911 CACACACAGTAGGTGCTCACAGG - Intergenic
1189159515 X:38797223-38797245 ACCAAAAAGATGGTGGTCTCAGG - Intergenic
1189473580 X:41333042-41333064 CCCGCAACGCCGGTGGTCACCGG + Intergenic
1189622579 X:42857759-42857781 GCCACCAAGTTGGTGGTCATTGG - Intergenic
1194334945 X:92634001-92634023 ACCACTGAGCTGGTGGTCACCGG + Intergenic
1198273368 X:135076823-135076845 CACACAATGTTGATGGTGACTGG + Intergenic
1200643422 Y:5751052-5751074 ACCACTGAGCTGGTGGTCACCGG + Intergenic
1200984715 Y:9292738-9292760 ACCTCAAAGTGGGTGCTCACAGG + Intergenic
1201569583 Y:15399728-15399750 CCCTCAAGGCTGCTGGTCACTGG - Intergenic