ID: 955451295

View in Genome Browser
Species Human (GRCh38)
Location 3:59069824-59069846
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
955451289_955451295 26 Left 955451289 3:59069775-59069797 CCAGAGACTTAAGAGCTAAAAAA No data
Right 955451295 3:59069824-59069846 TAATATACAAAGGTGGAACAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
No off target data available for this crispr