ID: 955451295 |
View in Genome Browser |
| Species | Human (GRCh38) |
| Location | 3:59069824-59069846 |
| Sequence | TAATATACAAAGGTGGAACA GGG |
| Strand | + |
| Crispr in exon? | No |
| Crispr in intron? | No |
| Off-Target Counts | All | Exonic | Intronic | Intergenic |
|---|---|---|---|---|
| Total | No data | |||
| Summary | No data |
Found 1 Related Crispr Pairs
Show Crispr Pairs| ID | Spacer | Status | Summary | ID | Location | Sequence | Summary | |
|---|---|---|---|---|---|---|---|---|
| 955451289_955451295 | 26 | Left | 955451289 | 3:59069775-59069797 | CCAGAGACTTAAGAGCTAAAAAA | No data | ||
| Right | 955451295 | 3:59069824-59069846 | TAATATACAAAGGTGGAACAGGG | No data |
Note: the row highlighted in blue is the original CRISPR
| WGE ID | Location | Sequence | Mismatches | Strand | Type |
|---|---|---|---|---|---|
| 955451295 | Original CRISPR | TAATATACAAAGGTGGAACA GGG | Intergenic | ||
| No off target data available for this crispr | |||||