ID: 955452476

View in Genome Browser
Species Human (GRCh38)
Location 3:59084641-59084663
Sequence CTGTAAGATGGGTGGGAATT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
955452476_955452484 28 Left 955452476 3:59084641-59084663 CCCAATTCCCACCCATCTTACAG No data
Right 955452484 3:59084692-59084714 AAGCTGAACTCAAAATGTCCTGG No data
955452476_955452483 -9 Left 955452476 3:59084641-59084663 CCCAATTCCCACCCATCTTACAG No data
Right 955452483 3:59084655-59084677 ATCTTACAGCTAAGAAAACTGGG No data
955452476_955452482 -10 Left 955452476 3:59084641-59084663 CCCAATTCCCACCCATCTTACAG No data
Right 955452482 3:59084654-59084676 CATCTTACAGCTAAGAAAACTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
955452476 Original CRISPR CTGTAAGATGGGTGGGAATT GGG (reversed) Intergenic
No off target data available for this crispr