ID: 955456032

View in Genome Browser
Species Human (GRCh38)
Location 3:59122737-59122759
Sequence CAGCGCCTCCACTTGAAAGT TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
955456031_955456032 8 Left 955456031 3:59122706-59122728 CCTTGAAAAGATAGGTCAGCACA No data
Right 955456032 3:59122737-59122759 CAGCGCCTCCACTTGAAAGTTGG No data
955456030_955456032 11 Left 955456030 3:59122703-59122725 CCTCCTTGAAAAGATAGGTCAGC No data
Right 955456032 3:59122737-59122759 CAGCGCCTCCACTTGAAAGTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
955456032 Original CRISPR CAGCGCCTCCACTTGAAAGT TGG Intergenic
No off target data available for this crispr