ID: 955458235

View in Genome Browser
Species Human (GRCh38)
Location 3:59149339-59149361
Sequence CAGGAGACCCAGAAGGAGGA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
955458235_955458240 4 Left 955458235 3:59149339-59149361 CCATCCTCCTTCTGGGTCTCCTG No data
Right 955458240 3:59149366-59149388 GTGTATGTTGGTTTGATTGATGG No data
955458235_955458238 -8 Left 955458235 3:59149339-59149361 CCATCCTCCTTCTGGGTCTCCTG No data
Right 955458238 3:59149354-59149376 GTCTCCTGCAATGTGTATGTTGG No data
955458235_955458241 23 Left 955458235 3:59149339-59149361 CCATCCTCCTTCTGGGTCTCCTG No data
Right 955458241 3:59149385-59149407 ATGGTATTGCACAAGTCTCTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
955458235 Original CRISPR CAGGAGACCCAGAAGGAGGA TGG (reversed) Intergenic
No off target data available for this crispr