ID: 955460622

View in Genome Browser
Species Human (GRCh38)
Location 3:59179002-59179024
Sequence TAGATAATGAAGGCCAGGTG TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
955460619_955460622 -9 Left 955460619 3:59178988-59179010 CCTCTATTCAGAAATAGATAATG No data
Right 955460622 3:59179002-59179024 TAGATAATGAAGGCCAGGTGTGG No data
955460617_955460622 2 Left 955460617 3:59178977-59178999 CCCATCAAAGTCCTCTATTCAGA No data
Right 955460622 3:59179002-59179024 TAGATAATGAAGGCCAGGTGTGG No data
955460618_955460622 1 Left 955460618 3:59178978-59179000 CCATCAAAGTCCTCTATTCAGAA No data
Right 955460622 3:59179002-59179024 TAGATAATGAAGGCCAGGTGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
955460622 Original CRISPR TAGATAATGAAGGCCAGGTG TGG Intergenic
No off target data available for this crispr