ID: 955463224

View in Genome Browser
Species Human (GRCh38)
Location 3:59208490-59208512
Sequence GGTCTCACTGGACTAAAATC GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
955463224_955463229 -2 Left 955463224 3:59208490-59208512 CCCGATTTTAGTCCAGTGAGACC No data
Right 955463229 3:59208511-59208533 CCCATGCTGGACTACAGACCTGG No data
955463224_955463231 4 Left 955463224 3:59208490-59208512 CCCGATTTTAGTCCAGTGAGACC No data
Right 955463231 3:59208517-59208539 CTGGACTACAGACCTGGAAGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
955463224 Original CRISPR GGTCTCACTGGACTAAAATC GGG (reversed) Intergenic
No off target data available for this crispr