ID: 955467448

View in Genome Browser
Species Human (GRCh38)
Location 3:59252022-59252044
Sequence CTTGACAAGAAGCTTTTGCA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
955467448_955467455 10 Left 955467448 3:59252022-59252044 CCATGCAAAAGCTTCTTGTCAAG No data
Right 955467455 3:59252055-59252077 GACCAGCTCCTTATGAAGGGAGG No data
955467448_955467453 6 Left 955467448 3:59252022-59252044 CCATGCAAAAGCTTCTTGTCAAG No data
Right 955467453 3:59252051-59252073 CTTGGACCAGCTCCTTATGAAGG No data
955467448_955467456 11 Left 955467448 3:59252022-59252044 CCATGCAAAAGCTTCTTGTCAAG No data
Right 955467456 3:59252056-59252078 ACCAGCTCCTTATGAAGGGAGGG No data
955467448_955467454 7 Left 955467448 3:59252022-59252044 CCATGCAAAAGCTTCTTGTCAAG No data
Right 955467454 3:59252052-59252074 TTGGACCAGCTCCTTATGAAGGG No data
955467448_955467458 14 Left 955467448 3:59252022-59252044 CCATGCAAAAGCTTCTTGTCAAG No data
Right 955467458 3:59252059-59252081 AGCTCCTTATGAAGGGAGGGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
955467448 Original CRISPR CTTGACAAGAAGCTTTTGCA TGG (reversed) Intergenic
No off target data available for this crispr