ID: 955469034

View in Genome Browser
Species Human (GRCh38)
Location 3:59266964-59266986
Sequence TTTAGGTTGTTTATGTGTCT TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
955469032_955469034 -6 Left 955469032 3:59266947-59266969 CCATTCATCAATGGACATTTAGG No data
Right 955469034 3:59266964-59266986 TTTAGGTTGTTTATGTGTCTTGG No data
955469030_955469034 9 Left 955469030 3:59266932-59266954 CCACATTTTCTGTATCCATTCAT 0: 38
1: 1665
2: 4288
3: 6571
4: 17403
Right 955469034 3:59266964-59266986 TTTAGGTTGTTTATGTGTCTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
955469034 Original CRISPR TTTAGGTTGTTTATGTGTCT TGG Intergenic
No off target data available for this crispr