ID: 955469523

View in Genome Browser
Species Human (GRCh38)
Location 3:59272153-59272175
Sequence CAATTCCAACAGCTAGCACC AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
955469517_955469523 23 Left 955469517 3:59272107-59272129 CCAATCCCTTTACTATTTTCGTG No data
Right 955469523 3:59272153-59272175 CAATTCCAACAGCTAGCACCAGG No data
955469522_955469523 -1 Left 955469522 3:59272131-59272153 CCTCAGGCTTTCACTGCACTTTC No data
Right 955469523 3:59272153-59272175 CAATTCCAACAGCTAGCACCAGG No data
955469519_955469523 17 Left 955469519 3:59272113-59272135 CCTTTACTATTTTCGTGCCCTCA No data
Right 955469523 3:59272153-59272175 CAATTCCAACAGCTAGCACCAGG No data
955469521_955469523 0 Left 955469521 3:59272130-59272152 CCCTCAGGCTTTCACTGCACTTT No data
Right 955469523 3:59272153-59272175 CAATTCCAACAGCTAGCACCAGG No data
955469518_955469523 18 Left 955469518 3:59272112-59272134 CCCTTTACTATTTTCGTGCCCTC No data
Right 955469523 3:59272153-59272175 CAATTCCAACAGCTAGCACCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
955469523 Original CRISPR CAATTCCAACAGCTAGCACC AGG Intergenic
No off target data available for this crispr