ID: 955470091

View in Genome Browser
Species Human (GRCh38)
Location 3:59277804-59277826
Sequence CCTGATAAGAATTTATTGTT TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
955470091_955470094 6 Left 955470091 3:59277804-59277826 CCAAACAATAAATTCTTATCAGG No data
Right 955470094 3:59277833-59277855 GAAAGGAGATTCATTGTGCCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
955470091 Original CRISPR CCTGATAAGAATTTATTGTT TGG (reversed) Intergenic
No off target data available for this crispr