ID: 955470301

View in Genome Browser
Species Human (GRCh38)
Location 3:59279677-59279699
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
955470301_955470309 26 Left 955470301 3:59279677-59279699 CCCACTCTTTTCCCTTCTCTACT No data
Right 955470309 3:59279726-59279748 ATATGTAGATCAATGGCTTTAGG No data
955470301_955470310 30 Left 955470301 3:59279677-59279699 CCCACTCTTTTCCCTTCTCTACT No data
Right 955470310 3:59279730-59279752 GTAGATCAATGGCTTTAGGTTGG No data
955470301_955470308 19 Left 955470301 3:59279677-59279699 CCCACTCTTTTCCCTTCTCTACT No data
Right 955470308 3:59279719-59279741 CTGATCTATATGTAGATCAATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
955470301 Original CRISPR AGTAGAGAAGGGAAAAGAGT GGG (reversed) Intergenic
No off target data available for this crispr