ID: 955470305

View in Genome Browser
Species Human (GRCh38)
Location 3:59279688-59279710
Sequence GCCCGGAAGCAAGTAGAGAA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
955470305_955470309 15 Left 955470305 3:59279688-59279710 CCCTTCTCTACTTGCTTCCGGGC No data
Right 955470309 3:59279726-59279748 ATATGTAGATCAATGGCTTTAGG No data
955470305_955470311 20 Left 955470305 3:59279688-59279710 CCCTTCTCTACTTGCTTCCGGGC No data
Right 955470311 3:59279731-59279753 TAGATCAATGGCTTTAGGTTGGG No data
955470305_955470310 19 Left 955470305 3:59279688-59279710 CCCTTCTCTACTTGCTTCCGGGC No data
Right 955470310 3:59279730-59279752 GTAGATCAATGGCTTTAGGTTGG No data
955470305_955470308 8 Left 955470305 3:59279688-59279710 CCCTTCTCTACTTGCTTCCGGGC No data
Right 955470308 3:59279719-59279741 CTGATCTATATGTAGATCAATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
955470305 Original CRISPR GCCCGGAAGCAAGTAGAGAA GGG (reversed) Intergenic
No off target data available for this crispr