ID: 955470306

View in Genome Browser
Species Human (GRCh38)
Location 3:59279689-59279711
Sequence AGCCCGGAAGCAAGTAGAGA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
955470306_955470312 30 Left 955470306 3:59279689-59279711 CCTTCTCTACTTGCTTCCGGGCT No data
Right 955470312 3:59279742-59279764 CTTTAGGTTGGGTTCAGCCAAGG No data
955470306_955470309 14 Left 955470306 3:59279689-59279711 CCTTCTCTACTTGCTTCCGGGCT No data
Right 955470309 3:59279726-59279748 ATATGTAGATCAATGGCTTTAGG No data
955470306_955470308 7 Left 955470306 3:59279689-59279711 CCTTCTCTACTTGCTTCCGGGCT No data
Right 955470308 3:59279719-59279741 CTGATCTATATGTAGATCAATGG No data
955470306_955470310 18 Left 955470306 3:59279689-59279711 CCTTCTCTACTTGCTTCCGGGCT No data
Right 955470310 3:59279730-59279752 GTAGATCAATGGCTTTAGGTTGG No data
955470306_955470311 19 Left 955470306 3:59279689-59279711 CCTTCTCTACTTGCTTCCGGGCT No data
Right 955470311 3:59279731-59279753 TAGATCAATGGCTTTAGGTTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
955470306 Original CRISPR AGCCCGGAAGCAAGTAGAGA AGG (reversed) Intergenic
No off target data available for this crispr