ID: 955470307

View in Genome Browser
Species Human (GRCh38)
Location 3:59279705-59279727
Sequence ATAGATCAGCATCTTCAGCC CGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 8 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
955470307_955470313 15 Left 955470307 3:59279705-59279727 CCGGGCTGAAGATGCTGATCTAT No data
Right 955470313 3:59279743-59279765 TTTAGGTTGGGTTCAGCCAAGGG No data
955470307_955470312 14 Left 955470307 3:59279705-59279727 CCGGGCTGAAGATGCTGATCTAT No data
Right 955470312 3:59279742-59279764 CTTTAGGTTGGGTTCAGCCAAGG No data
955470307_955470315 26 Left 955470307 3:59279705-59279727 CCGGGCTGAAGATGCTGATCTAT No data
Right 955470315 3:59279754-59279776 TTCAGCCAAGGGGAGATGTGAGG No data
955470307_955470308 -9 Left 955470307 3:59279705-59279727 CCGGGCTGAAGATGCTGATCTAT No data
Right 955470308 3:59279719-59279741 CTGATCTATATGTAGATCAATGG No data
955470307_955470314 16 Left 955470307 3:59279705-59279727 CCGGGCTGAAGATGCTGATCTAT No data
Right 955470314 3:59279744-59279766 TTAGGTTGGGTTCAGCCAAGGGG No data
955470307_955470311 3 Left 955470307 3:59279705-59279727 CCGGGCTGAAGATGCTGATCTAT No data
Right 955470311 3:59279731-59279753 TAGATCAATGGCTTTAGGTTGGG No data
955470307_955470309 -2 Left 955470307 3:59279705-59279727 CCGGGCTGAAGATGCTGATCTAT No data
Right 955470309 3:59279726-59279748 ATATGTAGATCAATGGCTTTAGG No data
955470307_955470310 2 Left 955470307 3:59279705-59279727 CCGGGCTGAAGATGCTGATCTAT No data
Right 955470310 3:59279730-59279752 GTAGATCAATGGCTTTAGGTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
955470307 Original CRISPR ATAGATCAGCATCTTCAGCC CGG (reversed) Intergenic
No off target data available for this crispr