ID: 955470308

View in Genome Browser
Species Human (GRCh38)
Location 3:59279719-59279741
Sequence CTGATCTATATGTAGATCAA TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
955470300_955470308 29 Left 955470300 3:59279667-59279689 CCACTCTAGACCCACTCTTTTCC No data
Right 955470308 3:59279719-59279741 CTGATCTATATGTAGATCAATGG No data
955470301_955470308 19 Left 955470301 3:59279677-59279699 CCCACTCTTTTCCCTTCTCTACT No data
Right 955470308 3:59279719-59279741 CTGATCTATATGTAGATCAATGG No data
955470307_955470308 -9 Left 955470307 3:59279705-59279727 CCGGGCTGAAGATGCTGATCTAT No data
Right 955470308 3:59279719-59279741 CTGATCTATATGTAGATCAATGG No data
955470302_955470308 18 Left 955470302 3:59279678-59279700 CCACTCTTTTCCCTTCTCTACTT No data
Right 955470308 3:59279719-59279741 CTGATCTATATGTAGATCAATGG No data
955470305_955470308 8 Left 955470305 3:59279688-59279710 CCCTTCTCTACTTGCTTCCGGGC No data
Right 955470308 3:59279719-59279741 CTGATCTATATGTAGATCAATGG No data
955470306_955470308 7 Left 955470306 3:59279689-59279711 CCTTCTCTACTTGCTTCCGGGCT No data
Right 955470308 3:59279719-59279741 CTGATCTATATGTAGATCAATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
955470308 Original CRISPR CTGATCTATATGTAGATCAA TGG Intergenic
No off target data available for this crispr