ID: 955470309

View in Genome Browser
Species Human (GRCh38)
Location 3:59279726-59279748
Sequence ATATGTAGATCAATGGCTTT AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
955470302_955470309 25 Left 955470302 3:59279678-59279700 CCACTCTTTTCCCTTCTCTACTT No data
Right 955470309 3:59279726-59279748 ATATGTAGATCAATGGCTTTAGG No data
955470307_955470309 -2 Left 955470307 3:59279705-59279727 CCGGGCTGAAGATGCTGATCTAT No data
Right 955470309 3:59279726-59279748 ATATGTAGATCAATGGCTTTAGG No data
955470301_955470309 26 Left 955470301 3:59279677-59279699 CCCACTCTTTTCCCTTCTCTACT No data
Right 955470309 3:59279726-59279748 ATATGTAGATCAATGGCTTTAGG No data
955470306_955470309 14 Left 955470306 3:59279689-59279711 CCTTCTCTACTTGCTTCCGGGCT No data
Right 955470309 3:59279726-59279748 ATATGTAGATCAATGGCTTTAGG No data
955470305_955470309 15 Left 955470305 3:59279688-59279710 CCCTTCTCTACTTGCTTCCGGGC No data
Right 955470309 3:59279726-59279748 ATATGTAGATCAATGGCTTTAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
955470309 Original CRISPR ATATGTAGATCAATGGCTTT AGG Intergenic
No off target data available for this crispr