ID: 955470311

View in Genome Browser
Species Human (GRCh38)
Location 3:59279731-59279753
Sequence TAGATCAATGGCTTTAGGTT GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
955470306_955470311 19 Left 955470306 3:59279689-59279711 CCTTCTCTACTTGCTTCCGGGCT No data
Right 955470311 3:59279731-59279753 TAGATCAATGGCTTTAGGTTGGG No data
955470307_955470311 3 Left 955470307 3:59279705-59279727 CCGGGCTGAAGATGCTGATCTAT No data
Right 955470311 3:59279731-59279753 TAGATCAATGGCTTTAGGTTGGG No data
955470305_955470311 20 Left 955470305 3:59279688-59279710 CCCTTCTCTACTTGCTTCCGGGC No data
Right 955470311 3:59279731-59279753 TAGATCAATGGCTTTAGGTTGGG No data
955470302_955470311 30 Left 955470302 3:59279678-59279700 CCACTCTTTTCCCTTCTCTACTT No data
Right 955470311 3:59279731-59279753 TAGATCAATGGCTTTAGGTTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
955470311 Original CRISPR TAGATCAATGGCTTTAGGTT GGG Intergenic
No off target data available for this crispr