ID: 955470462

View in Genome Browser
Species Human (GRCh38)
Location 3:59281636-59281658
Sequence ATGGGGGAGAAGAAGGAGGA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
955470462_955470475 25 Left 955470462 3:59281636-59281658 CCTTCCTCCTTCTTCTCCCCCAT No data
Right 955470475 3:59281684-59281706 TCTGTTGCTTCTTTCCAGAGGGG No data
955470462_955470470 1 Left 955470462 3:59281636-59281658 CCTTCCTCCTTCTTCTCCCCCAT No data
Right 955470470 3:59281660-59281682 CCTCTGTCCAAGAAGTCACCAGG No data
955470462_955470473 23 Left 955470462 3:59281636-59281658 CCTTCCTCCTTCTTCTCCCCCAT No data
Right 955470473 3:59281682-59281704 GCTCTGTTGCTTCTTTCCAGAGG No data
955470462_955470474 24 Left 955470462 3:59281636-59281658 CCTTCCTCCTTCTTCTCCCCCAT No data
Right 955470474 3:59281683-59281705 CTCTGTTGCTTCTTTCCAGAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
955470462 Original CRISPR ATGGGGGAGAAGAAGGAGGA AGG (reversed) Intergenic
No off target data available for this crispr