ID: 955472200

View in Genome Browser
Species Human (GRCh38)
Location 3:59297630-59297652
Sequence AGAGCCACCTGGATGTTTTA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 12 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
955472200_955472203 3 Left 955472200 3:59297630-59297652 CCATAAAACATCCAGGTGGCTCT No data
Right 955472203 3:59297656-59297678 CTTCAGTCTTGAAGCATGGTAGG No data
955472200_955472202 -1 Left 955472200 3:59297630-59297652 CCATAAAACATCCAGGTGGCTCT No data
Right 955472202 3:59297652-59297674 TCTGCTTCAGTCTTGAAGCATGG No data
955472200_955472211 23 Left 955472200 3:59297630-59297652 CCATAAAACATCCAGGTGGCTCT No data
Right 955472211 3:59297676-59297698 AGGGGGGGATTGGTGGACGATGG No data
955472200_955472204 4 Left 955472200 3:59297630-59297652 CCATAAAACATCCAGGTGGCTCT No data
Right 955472204 3:59297657-59297679 TTCAGTCTTGAAGCATGGTAGGG No data
955472200_955472206 6 Left 955472200 3:59297630-59297652 CCATAAAACATCCAGGTGGCTCT No data
Right 955472206 3:59297659-59297681 CAGTCTTGAAGCATGGTAGGGGG No data
955472200_955472205 5 Left 955472200 3:59297630-59297652 CCATAAAACATCCAGGTGGCTCT No data
Right 955472205 3:59297658-59297680 TCAGTCTTGAAGCATGGTAGGGG No data
955472200_955472212 24 Left 955472200 3:59297630-59297652 CCATAAAACATCCAGGTGGCTCT No data
Right 955472212 3:59297677-59297699 GGGGGGGATTGGTGGACGATGGG No data
955472200_955472207 7 Left 955472200 3:59297630-59297652 CCATAAAACATCCAGGTGGCTCT No data
Right 955472207 3:59297660-59297682 AGTCTTGAAGCATGGTAGGGGGG No data
955472200_955472213 25 Left 955472200 3:59297630-59297652 CCATAAAACATCCAGGTGGCTCT No data
Right 955472213 3:59297678-59297700 GGGGGGATTGGTGGACGATGGGG No data
955472200_955472208 8 Left 955472200 3:59297630-59297652 CCATAAAACATCCAGGTGGCTCT No data
Right 955472208 3:59297661-59297683 GTCTTGAAGCATGGTAGGGGGGG No data
955472200_955472209 13 Left 955472200 3:59297630-59297652 CCATAAAACATCCAGGTGGCTCT No data
Right 955472209 3:59297666-59297688 GAAGCATGGTAGGGGGGGATTGG No data
955472200_955472210 16 Left 955472200 3:59297630-59297652 CCATAAAACATCCAGGTGGCTCT No data
Right 955472210 3:59297669-59297691 GCATGGTAGGGGGGGATTGGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
955472200 Original CRISPR AGAGCCACCTGGATGTTTTA TGG (reversed) Intergenic
No off target data available for this crispr