ID: 955474331

View in Genome Browser
Species Human (GRCh38)
Location 3:59320290-59320312
Sequence ACAGTTTGTAGAACTGCCTC TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
955474329_955474331 -5 Left 955474329 3:59320272-59320294 CCAGGGAGGAGCTTTCCAACAGT No data
Right 955474331 3:59320290-59320312 ACAGTTTGTAGAACTGCCTCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
955474331 Original CRISPR ACAGTTTGTAGAACTGCCTC TGG Intergenic
No off target data available for this crispr