ID: 955475057

View in Genome Browser
Species Human (GRCh38)
Location 3:59327961-59327983
Sequence CAAGATGCTCTCAATGATAA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
955475057_955475059 1 Left 955475057 3:59327961-59327983 CCATTATCATTGAGAGCATCTTG No data
Right 955475059 3:59327985-59328007 CTACTGAAGTATGCGAGCTGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
955475057 Original CRISPR CAAGATGCTCTCAATGATAA TGG (reversed) Intergenic
No off target data available for this crispr