ID: 955482535

View in Genome Browser
Species Human (GRCh38)
Location 3:59404186-59404208
Sequence CCTTATAGGCAGAGGCATGA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
955482535_955482540 25 Left 955482535 3:59404186-59404208 CCCTCATGCCTCTGCCTATAAGG No data
Right 955482540 3:59404234-59404256 ATTCTTTATAGCACTGAATCTGG No data
955482535_955482541 26 Left 955482535 3:59404186-59404208 CCCTCATGCCTCTGCCTATAAGG No data
Right 955482541 3:59404235-59404257 TTCTTTATAGCACTGAATCTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
955482535 Original CRISPR CCTTATAGGCAGAGGCATGA GGG (reversed) Intergenic
No off target data available for this crispr