ID: 955483710

View in Genome Browser
Species Human (GRCh38)
Location 3:59414718-59414740
Sequence GAAACAATGACAGCTAGAGC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
955483710_955483711 -9 Left 955483710 3:59414718-59414740 CCTGCTCTAGCTGTCATTGTTTC No data
Right 955483711 3:59414732-59414754 CATTGTTTCCTTCCCTCTCTAGG No data
955483710_955483715 23 Left 955483710 3:59414718-59414740 CCTGCTCTAGCTGTCATTGTTTC No data
Right 955483715 3:59414764-59414786 TACCCTTCTCTCATATTCTCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
955483710 Original CRISPR GAAACAATGACAGCTAGAGC AGG (reversed) Intergenic
No off target data available for this crispr