ID: 955483711

View in Genome Browser
Species Human (GRCh38)
Location 3:59414732-59414754
Sequence CATTGTTTCCTTCCCTCTCT AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
955483709_955483711 -1 Left 955483709 3:59414710-59414732 CCTTCTATCCTGCTCTAGCTGTC No data
Right 955483711 3:59414732-59414754 CATTGTTTCCTTCCCTCTCTAGG No data
955483707_955483711 22 Left 955483707 3:59414687-59414709 CCTGTCCTGCATAACGTTTATGA No data
Right 955483711 3:59414732-59414754 CATTGTTTCCTTCCCTCTCTAGG No data
955483708_955483711 17 Left 955483708 3:59414692-59414714 CCTGCATAACGTTTATGACCTTC No data
Right 955483711 3:59414732-59414754 CATTGTTTCCTTCCCTCTCTAGG No data
955483710_955483711 -9 Left 955483710 3:59414718-59414740 CCTGCTCTAGCTGTCATTGTTTC No data
Right 955483711 3:59414732-59414754 CATTGTTTCCTTCCCTCTCTAGG No data
955483706_955483711 23 Left 955483706 3:59414686-59414708 CCCTGTCCTGCATAACGTTTATG No data
Right 955483711 3:59414732-59414754 CATTGTTTCCTTCCCTCTCTAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
955483711 Original CRISPR CATTGTTTCCTTCCCTCTCT AGG Intergenic