ID: 955483715

View in Genome Browser
Species Human (GRCh38)
Location 3:59414764-59414786
Sequence TACCCTTCTCTCATATTCTC TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
955483712_955483715 1 Left 955483712 3:59414740-59414762 CCTTCCCTCTCTAGGTTTCTTTG No data
Right 955483715 3:59414764-59414786 TACCCTTCTCTCATATTCTCTGG No data
955483714_955483715 -4 Left 955483714 3:59414745-59414767 CCTCTCTAGGTTTCTTTGATACC No data
Right 955483715 3:59414764-59414786 TACCCTTCTCTCATATTCTCTGG No data
955483710_955483715 23 Left 955483710 3:59414718-59414740 CCTGCTCTAGCTGTCATTGTTTC No data
Right 955483715 3:59414764-59414786 TACCCTTCTCTCATATTCTCTGG No data
955483713_955483715 -3 Left 955483713 3:59414744-59414766 CCCTCTCTAGGTTTCTTTGATAC No data
Right 955483715 3:59414764-59414786 TACCCTTCTCTCATATTCTCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
955483715 Original CRISPR TACCCTTCTCTCATATTCTC TGG Intergenic