ID: 955483715 |
View in Genome Browser |
Species | Human (GRCh38) |
Location | 3:59414764-59414786 |
Sequence | TACCCTTCTCTCATATTCTC TGG |
Strand | + |
Crispr in exon? | No |
Crispr in intron? | No |
Off-Target Counts | All | Exonic | Intronic | Intergenic |
---|---|---|---|---|
Total | ||||
Summary |
Found 4 Related Crispr Pairs
Show Crispr PairsID | Spacer | Status | Summary | ID | Location | Sequence | Summary | |
---|---|---|---|---|---|---|---|---|
955483712_955483715 | 1 | Left | 955483712 | 3:59414740-59414762 | CCTTCCCTCTCTAGGTTTCTTTG | No data | ||
Right | 955483715 | 3:59414764-59414786 | TACCCTTCTCTCATATTCTCTGG | No data | ||||
955483714_955483715 | -4 | Left | 955483714 | 3:59414745-59414767 | CCTCTCTAGGTTTCTTTGATACC | No data | ||
Right | 955483715 | 3:59414764-59414786 | TACCCTTCTCTCATATTCTCTGG | No data | ||||
955483710_955483715 | 23 | Left | 955483710 | 3:59414718-59414740 | CCTGCTCTAGCTGTCATTGTTTC | No data | ||
Right | 955483715 | 3:59414764-59414786 | TACCCTTCTCTCATATTCTCTGG | No data | ||||
955483713_955483715 | -3 | Left | 955483713 | 3:59414744-59414766 | CCCTCTCTAGGTTTCTTTGATAC | No data | ||
Right | 955483715 | 3:59414764-59414786 | TACCCTTCTCTCATATTCTCTGG | No data |
Note: the row highlighted in blue is the original CRISPR
WGE ID | Location | Sequence | Mismatches | Strand | Type |
---|---|---|---|---|---|
955483715 | Original CRISPR | TACCCTTCTCTCATATTCTC TGG | Intergenic | ||