ID: 955485015

View in Genome Browser
Species Human (GRCh38)
Location 3:59426427-59426449
Sequence CTGTCTTCAAAGATGGAGAA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
955485015_955485019 26 Left 955485015 3:59426427-59426449 CCTTTCTCCATCTTTGAAGACAG No data
Right 955485019 3:59426476-59426498 TTCCGCAGTCACATCTCCCTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
955485015 Original CRISPR CTGTCTTCAAAGATGGAGAA AGG (reversed) Intergenic
No off target data available for this crispr