ID: 955485019

View in Genome Browser
Species Human (GRCh38)
Location 3:59426476-59426498
Sequence TTCCGCAGTCACATCTCCCT TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
955485014_955485019 27 Left 955485014 3:59426426-59426448 CCCTTTCTCCATCTTTGAAGACA No data
Right 955485019 3:59426476-59426498 TTCCGCAGTCACATCTCCCTTGG No data
955485016_955485019 19 Left 955485016 3:59426434-59426456 CCATCTTTGAAGACAGCAATGTT No data
Right 955485019 3:59426476-59426498 TTCCGCAGTCACATCTCCCTTGG No data
955485015_955485019 26 Left 955485015 3:59426427-59426449 CCTTTCTCCATCTTTGAAGACAG No data
Right 955485019 3:59426476-59426498 TTCCGCAGTCACATCTCCCTTGG No data
955485013_955485019 28 Left 955485013 3:59426425-59426447 CCCCTTTCTCCATCTTTGAAGAC No data
Right 955485019 3:59426476-59426498 TTCCGCAGTCACATCTCCCTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
955485019 Original CRISPR TTCCGCAGTCACATCTCCCT TGG Intergenic
No off target data available for this crispr