ID: 955485157

View in Genome Browser
Species Human (GRCh38)
Location 3:59427807-59427829
Sequence TTCCTCCTGTAGGCTCCAGG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
955485157_955485163 2 Left 955485157 3:59427807-59427829 CCTCCTGGAGCCTACAGGAGGAA No data
Right 955485163 3:59427832-59427854 AGACAGATAAGTAGGTAGGGAGG No data
955485157_955485164 14 Left 955485157 3:59427807-59427829 CCTCCTGGAGCCTACAGGAGGAA No data
Right 955485164 3:59427844-59427866 AGGTAGGGAGGAAGTAGCCAAGG No data
955485157_955485162 -1 Left 955485157 3:59427807-59427829 CCTCCTGGAGCCTACAGGAGGAA No data
Right 955485162 3:59427829-59427851 AAAAGACAGATAAGTAGGTAGGG No data
955485157_955485160 -6 Left 955485157 3:59427807-59427829 CCTCCTGGAGCCTACAGGAGGAA No data
Right 955485160 3:59427824-59427846 GAGGAAAAAGACAGATAAGTAGG No data
955485157_955485161 -2 Left 955485157 3:59427807-59427829 CCTCCTGGAGCCTACAGGAGGAA No data
Right 955485161 3:59427828-59427850 AAAAAGACAGATAAGTAGGTAGG No data
955485157_955485165 15 Left 955485157 3:59427807-59427829 CCTCCTGGAGCCTACAGGAGGAA No data
Right 955485165 3:59427845-59427867 GGTAGGGAGGAAGTAGCCAAGGG No data
955485157_955485166 18 Left 955485157 3:59427807-59427829 CCTCCTGGAGCCTACAGGAGGAA No data
Right 955485166 3:59427848-59427870 AGGGAGGAAGTAGCCAAGGGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
955485157 Original CRISPR TTCCTCCTGTAGGCTCCAGG AGG (reversed) Intergenic