ID: 955487978

View in Genome Browser
Species Human (GRCh38)
Location 3:59454022-59454044
Sequence AACAAAACAACAAAACAAGC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
955487978_955487982 25 Left 955487978 3:59454022-59454044 CCAGCTTGTTTTGTTGTTTTGTT No data
Right 955487982 3:59454070-59454092 CAGTTAAATCTTGAAGAGGAAGG No data
955487978_955487981 21 Left 955487978 3:59454022-59454044 CCAGCTTGTTTTGTTGTTTTGTT No data
Right 955487981 3:59454066-59454088 AATACAGTTAAATCTTGAAGAGG No data
955487978_955487983 26 Left 955487978 3:59454022-59454044 CCAGCTTGTTTTGTTGTTTTGTT No data
Right 955487983 3:59454071-59454093 AGTTAAATCTTGAAGAGGAAGGG No data
955487978_955487979 -3 Left 955487978 3:59454022-59454044 CCAGCTTGTTTTGTTGTTTTGTT No data
Right 955487979 3:59454042-59454064 GTTTTGAGAAGCCAAGAGAGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
955487978 Original CRISPR AACAAAACAACAAAACAAGC TGG (reversed) Intergenic
No off target data available for this crispr