ID: 955487980

View in Genome Browser
Species Human (GRCh38)
Location 3:59454053-59454075
Sequence TAACTGTATTGCCACTCTCT TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
955487980_955487983 -5 Left 955487980 3:59454053-59454075 CCAAGAGAGTGGCAATACAGTTA No data
Right 955487983 3:59454071-59454093 AGTTAAATCTTGAAGAGGAAGGG No data
955487980_955487981 -10 Left 955487980 3:59454053-59454075 CCAAGAGAGTGGCAATACAGTTA No data
Right 955487981 3:59454066-59454088 AATACAGTTAAATCTTGAAGAGG No data
955487980_955487982 -6 Left 955487980 3:59454053-59454075 CCAAGAGAGTGGCAATACAGTTA No data
Right 955487982 3:59454070-59454092 CAGTTAAATCTTGAAGAGGAAGG No data
955487980_955487984 9 Left 955487980 3:59454053-59454075 CCAAGAGAGTGGCAATACAGTTA No data
Right 955487984 3:59454085-59454107 GAGGAAGGGCTTGTGAACTCAGG No data
955487980_955487985 10 Left 955487980 3:59454053-59454075 CCAAGAGAGTGGCAATACAGTTA No data
Right 955487985 3:59454086-59454108 AGGAAGGGCTTGTGAACTCAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
955487980 Original CRISPR TAACTGTATTGCCACTCTCT TGG (reversed) Intergenic
No off target data available for this crispr