ID: 955487982

View in Genome Browser
Species Human (GRCh38)
Location 3:59454070-59454092
Sequence CAGTTAAATCTTGAAGAGGA AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
955487978_955487982 25 Left 955487978 3:59454022-59454044 CCAGCTTGTTTTGTTGTTTTGTT No data
Right 955487982 3:59454070-59454092 CAGTTAAATCTTGAAGAGGAAGG No data
955487980_955487982 -6 Left 955487980 3:59454053-59454075 CCAAGAGAGTGGCAATACAGTTA No data
Right 955487982 3:59454070-59454092 CAGTTAAATCTTGAAGAGGAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
955487982 Original CRISPR CAGTTAAATCTTGAAGAGGA AGG Intergenic
No off target data available for this crispr