ID: 955487985

View in Genome Browser
Species Human (GRCh38)
Location 3:59454086-59454108
Sequence AGGAAGGGCTTGTGAACTCA GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
955487980_955487985 10 Left 955487980 3:59454053-59454075 CCAAGAGAGTGGCAATACAGTTA No data
Right 955487985 3:59454086-59454108 AGGAAGGGCTTGTGAACTCAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
955487985 Original CRISPR AGGAAGGGCTTGTGAACTCA GGG Intergenic
No off target data available for this crispr