ID: 955503359

View in Genome Browser
Species Human (GRCh38)
Location 3:59606793-59606815
Sequence TGCCCCAAATTAGCCCAAAC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
955503359_955503362 -2 Left 955503359 3:59606793-59606815 CCTGTTTGGGCTAATTTGGGGCA No data
Right 955503362 3:59606814-59606836 CATCAGGAGGTCTGTGCTTAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
955503359 Original CRISPR TGCCCCAAATTAGCCCAAAC AGG (reversed) Intergenic