ID: 955505285

View in Genome Browser
Species Human (GRCh38)
Location 3:59626562-59626584
Sequence GCAAAGTGGTCTGCTGCCAC CGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
955505279_955505285 27 Left 955505279 3:59626512-59626534 CCATTAGGCATAGAAACAGTAGA No data
Right 955505285 3:59626562-59626584 GCAAAGTGGTCTGCTGCCACCGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
955505285 Original CRISPR GCAAAGTGGTCTGCTGCCAC CGG Intergenic
No off target data available for this crispr