ID: 955506252

View in Genome Browser
Species Human (GRCh38)
Location 3:59636118-59636140
Sequence CTATTTAGCTAGAAGGCAGT AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
955506246_955506252 8 Left 955506246 3:59636087-59636109 CCATAGTGTGAGGTTTATTCCCC No data
Right 955506252 3:59636118-59636140 CTATTTAGCTAGAAGGCAGTAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
955506252 Original CRISPR CTATTTAGCTAGAAGGCAGT AGG Intergenic
No off target data available for this crispr