ID: 955507260

View in Genome Browser
Species Human (GRCh38)
Location 3:59644860-59644882
Sequence GAACCCTCTGTGCCCGCTTG GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
955507260_955507270 30 Left 955507260 3:59644860-59644882 CCCCAAGCGGGCACAGAGGGTTC No data
Right 955507270 3:59644913-59644935 AGCCTGTGTCACTGCAATAGTGG No data
955507260_955507263 -1 Left 955507260 3:59644860-59644882 CCCCAAGCGGGCACAGAGGGTTC No data
Right 955507263 3:59644882-59644904 CATTATTCCCAACTCCCTTATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
955507260 Original CRISPR GAACCCTCTGTGCCCGCTTG GGG (reversed) Intergenic
No off target data available for this crispr