ID: 955508794

View in Genome Browser
Species Human (GRCh38)
Location 3:59658712-59658734
Sequence GGTACCAGTAGACCACCAGC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
955508794_955508796 10 Left 955508794 3:59658712-59658734 CCAGCTGGTGGTCTACTGGTACC No data
Right 955508796 3:59658745-59658767 AAAAAAAAAAAAAAAAAGAAAGG 0: 1844
1: 28429
2: 37889
3: 70941
4: 139023
955508794_955508797 26 Left 955508794 3:59658712-59658734 CCAGCTGGTGGTCTACTGGTACC No data
Right 955508797 3:59658761-59658783 AGAAAGGAGAGAGATAGAAGAGG No data
955508794_955508798 30 Left 955508794 3:59658712-59658734 CCAGCTGGTGGTCTACTGGTACC No data
Right 955508798 3:59658765-59658787 AGGAGAGAGATAGAAGAGGAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
955508794 Original CRISPR GGTACCAGTAGACCACCAGC TGG (reversed) Intergenic
No off target data available for this crispr