ID: 955519692

View in Genome Browser
Species Human (GRCh38)
Location 3:59763044-59763066
Sequence CAATATCTGAAACACCGGCG GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 34
Summary {0: 1, 1: 0, 2: 0, 3: 1, 4: 32}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
955519692 Original CRISPR CAATATCTGAAACACCGGCG GGG (reversed) Intronic
902304493 1:15525754-15525776 CTACATCTGTAAAACCGGCGGGG - Intronic
918404454 1:184197856-184197878 CAATATGAGAAACACTGTCGTGG + Intergenic
1066375089 10:34850940-34850962 CAATTTCTGAATCACCCGGGAGG + Intergenic
1084223475 11:67699569-67699591 CAATATCTGGCACACCAACGTGG + Intergenic
1097806410 12:63969496-63969518 AAAAATCTGAAACATCGGCCAGG + Intronic
1105861629 13:24420262-24420284 AAAACTCTGAAACACCGGCTGGG + Intergenic
1105918264 13:24937621-24937643 AAAGCTCTGAAACACCGGCTGGG - Intergenic
1114675175 14:24435521-24435543 CAATATCTGAATTACTGGGGTGG + Intronic
1115439765 14:33420008-33420030 CATTATCTGAAACACCGGACTGG + Intronic
1128502014 15:68233282-68233304 CAATGTATGAAACACCTACGGGG + Intronic
1128758853 15:70201278-70201300 CAATATCTTTTACACCGGCCGGG + Intergenic
1134910180 16:18018774-18018796 CAATATCTGACACACAGAAGGGG - Intergenic
1135096794 16:19571164-19571186 TAATATATGAAACACAGGCCGGG - Intronic
1142740093 17:1926872-1926894 AAAAATCTGAAATACGGGCGGGG + Intergenic
1152023351 17:77793360-77793382 CATTGTCTGAAACCCCTGCGTGG + Intergenic
1154312416 18:13277490-13277512 CAAAATCTGAAGCACCAGCTGGG + Intronic
1155666399 18:28314891-28314913 CAATTTCTGTAACACCAGCAGGG - Intergenic
1159008598 18:63037213-63037235 CAATATCTACATCACCGGGGCGG - Intergenic
1160016214 18:75142718-75142740 CAATATTTGAAAAACAAGCGAGG - Intergenic
1160294296 18:77623255-77623277 CAATTTCTTTAACACCGGCACGG + Intergenic
942588341 2:177511391-177511413 CAAAATCTGTAACATCGGCTAGG - Intronic
1170786335 20:19470867-19470889 CAATAGCTGTAACACCAGTGTGG + Intronic
1174990616 20:55505281-55505303 CAACATCTGAAACACAGCCTGGG - Intergenic
955519692 3:59763044-59763066 CAATATCTGAAACACCGGCGGGG - Intronic
958782923 3:98564552-98564574 CAATATCTGAAATAACCCCGAGG - Intronic
997709295 5:135990496-135990518 CAAGATCTGAAAGACGGGCTGGG + Intergenic
1001691660 5:173637516-173637538 CAATATTTGAAAGATCTGCGGGG + Intergenic
1004331785 6:14728626-14728648 CAATATCTAGAACACAGGCCTGG + Intergenic
1039997234 8:42544114-42544136 CAATATGTCAAATACCGGCCGGG + Intronic
1053203459 9:36167785-36167807 AAATATCTCAAGCACCGGCCGGG + Intergenic
1185472413 X:392035-392057 CAAAACCTGAAACACAGCCGTGG - Intergenic
1188779726 X:34266845-34266867 CACAATCTGAAACACTGGAGAGG - Intergenic
1195996504 X:110737015-110737037 CATTATCTGAAACTCCAGCTAGG + Intronic
1197874278 X:131087213-131087235 CATTATCTGAAGCATCTGCGTGG - Intronic