ID: 955521860

View in Genome Browser
Species Human (GRCh38)
Location 3:59783107-59783129
Sequence GGATGGAAACAAATTCCTCT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 237
Summary {0: 1, 1: 0, 2: 0, 3: 16, 4: 220}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
955521860_955521868 18 Left 955521860 3:59783107-59783129 CCCAGAGGAATTTGTTTCCATCC 0: 1
1: 0
2: 0
3: 16
4: 220
Right 955521868 3:59783148-59783170 ACAAACCTCTAATAGTACACAGG 0: 1
1: 0
2: 0
3: 5
4: 72

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
955521860 Original CRISPR GGATGGAAACAAATTCCTCT GGG (reversed) Intronic
901266701 1:7916029-7916051 AGATGGAAACATCTTCCTGTGGG + Exonic
904578903 1:31525006-31525028 GGAGGGAAACAAATTCAGTTTGG + Intergenic
904865940 1:33578881-33578903 GTAGGGAAACAAATTCGGCTTGG - Intronic
906779562 1:48560468-48560490 GGTTGGACACAAATGCCCCTGGG + Intronic
908126035 1:61031141-61031163 GGATGGAAAAAAACTACTGTAGG - Intronic
910857619 1:91711272-91711294 GTATGCAAACAAAATTCTCTTGG + Intronic
911447408 1:98014825-98014847 GGCTGGAAACATATACTTCTAGG + Intergenic
912118791 1:106442113-106442135 GGAAGGAAAAAAATTACTCTGGG - Intergenic
912194198 1:107378461-107378483 GGATGGATACACATTGGTCTTGG + Intronic
912641841 1:111353711-111353733 GGAGTGAAACAAAGGCCTCTGGG + Intergenic
913697642 1:121343286-121343308 GGATGGAATTAGATTCCACTGGG - Intronic
913986338 1:143569444-143569466 GGAGGGAAGCCAACTCCTCTAGG - Intergenic
914139917 1:144936765-144936787 GGATGGAATTAGATTCCACTGGG + Intronic
914463623 1:147907747-147907769 GGATGGAAGCACATTCTTCGGGG + Intergenic
915300121 1:154946931-154946953 GGATGAAAACCAAATCCTCTGGG - Intronic
915300607 1:154949436-154949458 GGATGAAAACCAAATCCTCTGGG - Intronic
918004141 1:180526010-180526032 AGATAGAAAGAAATTCCTCATGG - Intergenic
918376690 1:183916484-183916506 CCATGGACACAAATTCCTCAGGG + Exonic
919725854 1:200883011-200883033 GGATGGAGACAAATTATTCATGG - Intergenic
919997162 1:202763105-202763127 CGATGAAATCAAATTCCTGTTGG + Intronic
920485031 1:206361936-206361958 GGATGGAATTAGATTCCACTGGG - Intronic
924455106 1:244213009-244213031 GGATTGGAACAAATTCTTCTGGG + Intergenic
1065377456 10:25058102-25058124 GGAAGGAAACAGATTACTCGTGG - Intronic
1066237416 10:33499636-33499658 GAATATAAATAAATTCCTCTTGG - Intergenic
1067150605 10:43729540-43729562 AAATGCAAACAAATTCCTCCAGG - Intergenic
1069869545 10:71524843-71524865 GGAAGGAAACAGATTTCCCTTGG + Intronic
1071500042 10:86196894-86196916 GGAAAGAAACAAATGCTTCTGGG + Intronic
1072328114 10:94318592-94318614 GGATGGACACAATTTCAGCTTGG - Intronic
1072847303 10:98845929-98845951 GAATGGAAAAGAATTCCTATTGG - Intronic
1072917621 10:99548929-99548951 GGATGGAAATGGATTTCTCTTGG + Intergenic
1074061739 10:109972679-109972701 GTATGGAAACAACTTCCTGCTGG - Intergenic
1076401510 10:130188571-130188593 GGAGGGAGACATGTTCCTCTGGG + Intergenic
1079991534 11:27251558-27251580 GGAAGGAAATAAATTCTTCTTGG - Intergenic
1082740172 11:56902115-56902137 GGTTGGAAAGAAATATCTCTTGG - Intergenic
1086137723 11:83459068-83459090 GTATAGAAACAAATTTCTATAGG - Exonic
1087265488 11:96056130-96056152 GGATGGAACCAAATTACTTTTGG + Intronic
1087599622 11:100296668-100296690 GGAAGAAAACAAATTCTCCTTGG - Intronic
1088700085 11:112403822-112403844 GGAGGAAAAAATATTCCTCTGGG + Intergenic
1089222961 11:116890434-116890456 GAATGTAAACAAATGCCACTGGG + Intronic
1089289722 11:117430319-117430341 GGATGGAAACAGATCCCTTCAGG - Intronic
1089743687 11:120602332-120602354 GGATGGTAATCAATTCCTATAGG - Intronic
1089915449 11:122151039-122151061 GCATGGAAACAATGTCGTCTTGG + Intergenic
1091200973 11:133781077-133781099 GGTTGGAAAAAAATTCTTTTTGG + Intergenic
1091908763 12:4211798-4211820 GGAGGCAAACAAGATCCTCTGGG + Intergenic
1092312795 12:7376091-7376113 GAATGGAGAAAAATTGCTCTGGG - Intronic
1092705287 12:11277198-11277220 TGTTGGAAACAAATTCTTTTAGG + Intergenic
1094529366 12:31259337-31259359 GAATGGAGCCAAATTCTTCTGGG + Intergenic
1096911267 12:54986727-54986749 GGATCAAAACAAATACCTATTGG - Intergenic
1099517855 12:83620969-83620991 GGATGGAAACACATTTATATTGG - Intergenic
1101566819 12:105913901-105913923 GGAGGCACACAAATTCCTATTGG - Intergenic
1103206483 12:119133454-119133476 GGATAGAAAGAAATTGGTCTGGG - Intronic
1103612778 12:122134028-122134050 GGATGGGAAAACATCCCTCTGGG - Intronic
1106163853 13:27224560-27224582 GGATGTAAAGAAATTAATCTAGG - Intergenic
1107461664 13:40609710-40609732 GGGGGGAAAAAAATTCCTCAAGG + Intronic
1108335409 13:49436182-49436204 TGATGAAGAAAAATTCCTCTGGG - Intronic
1112315898 13:98361816-98361838 GGATGGAAACAACATCCTAAGGG - Intronic
1112500112 13:99936400-99936422 GGATGGAATCTTATTCCTCTTGG + Intergenic
1117254482 14:53963896-53963918 GGATGGATGCAAATTCCGCGCGG - Intergenic
1117668372 14:58080555-58080577 GGATGGAAACAACTAACACTGGG + Intronic
1117842406 14:59873413-59873435 GGCTGGAAAGAATTTCATCTTGG - Intergenic
1121183249 14:91945427-91945449 GCATGGAAAGAAATACCTATTGG + Intronic
1123690638 15:22835921-22835943 AGATGCCAACAAATACCTCTAGG - Intergenic
1124478448 15:30057676-30057698 GGATGGTAAGAAAAGCCTCTGGG + Intergenic
1124891520 15:33738084-33738106 GGGTGGAAATAATTTCTTCTGGG - Intronic
1126242508 15:46461429-46461451 GTATGGAAACATATCCCTCATGG - Intergenic
1126447706 15:48767512-48767534 GGAAGGAAACCAATTCATTTTGG - Intronic
1127500875 15:59553252-59553274 GAAAGGAAACTATTTCCTCTGGG - Intergenic
1127980893 15:64034243-64034265 GGAAAGAAACAACATCCTCTAGG - Intronic
1129426181 15:75464755-75464777 GGAAGGAACCAAATTTCCCTAGG + Exonic
1130432940 15:83867289-83867311 GGATCTAAACAAACACCTCTAGG - Intronic
1134101354 16:11454194-11454216 GGTTGGAAATAATTTTCTCTTGG - Intronic
1135227694 16:20675545-20675567 GCATGGAAACCAACTCCTTTTGG + Intronic
1136270300 16:29144492-29144514 GGATGGAGAAAAATTCCTTCAGG - Intergenic
1136363134 16:29794438-29794460 GGATGGAAAATAATTTCCCTAGG + Intronic
1138489359 16:57367078-57367100 GGACGGCAAAAATTTCCTCTGGG - Intergenic
1138565148 16:57827676-57827698 GGATGGTCACAAATTTCCCTGGG + Intronic
1138728116 16:59163146-59163168 GGATGGAAATAAATTCTGTTGGG + Intergenic
1142073890 16:88106326-88106348 GGATGGAGAAAAATTCCTTCAGG - Intronic
1143840124 17:9725293-9725315 GGCTGGAAACAGAATCTTCTCGG + Intronic
1145141421 17:20451375-20451397 GGATGGAAGCTGATGCCTCTGGG - Intronic
1146634619 17:34494806-34494828 GTTTGGAAACTATTTCCTCTGGG - Intergenic
1148481059 17:47959626-47959648 GGATGAAAAGAAGTTTCTCTTGG - Intergenic
1150232880 17:63567872-63567894 GGCTGGTCTCAAATTCCTCTTGG + Intronic
1151688948 17:75668070-75668092 TAATGGAAACAGATTCCTTTGGG + Intronic
1151817097 17:76476773-76476795 GGAAGGTTCCAAATTCCTCTGGG - Intronic
1153934859 18:9912689-9912711 GGCTGAAAACACATTCCTCGTGG + Intergenic
1155561193 18:27079035-27079057 TGATGGAGACAAATACCTGTGGG - Intronic
1157380384 18:47209574-47209596 GGATGGAAACAAAATCAGCATGG + Intergenic
1158089002 18:53688162-53688184 GGATAGAAAAAAATTCTTTTAGG + Intergenic
1158112177 18:53952402-53952424 GGAGGGAAACAAAATCCTGTAGG + Intergenic
1158437263 18:57442222-57442244 GGATGAGAACTAATTCTTCTGGG + Intronic
1159442161 18:68495161-68495183 GGAGGAAAATAAATTCCTATTGG + Intergenic
1159457635 18:68681384-68681406 GTATTGAAAAAAATTCCTATGGG + Intronic
1159779658 18:72646216-72646238 ATATGGAAACAGTTTCCTCTTGG + Intergenic
1160123057 18:76147557-76147579 GGAAGGAACCAACTCCCTCTGGG + Intergenic
1162996426 19:14338809-14338831 GGATGGAAAAACGTTGCTCTGGG + Intergenic
1164061052 19:21674224-21674246 GGATGTAAAATAATTTCTCTTGG - Intergenic
1164266897 19:23627298-23627320 GGATGTAAAATAATTTCTCTTGG - Intronic
1164395134 19:27856462-27856484 GGATGAAATCAACTTCATCTTGG - Intergenic
1164801352 19:31079422-31079444 GAGAGGAAACAAATGCCTCTGGG - Intergenic
1165019343 19:32910379-32910401 GACTGGAAAGAAATTGCTCTGGG + Intronic
925019873 2:560134-560156 AGATGGAGACAAATACCTCTGGG - Intergenic
925711943 2:6749911-6749933 GGTTGGACAAAAATTCCTATAGG - Intergenic
926357467 2:12054731-12054753 GGATGGAAAGAAATTTTTGTCGG - Intergenic
926961183 2:18360060-18360082 AGAGGGAAACATATTGCTCTTGG + Intronic
933703394 2:85272265-85272287 GGATTGAAAATAATTCATCTGGG + Intronic
935847547 2:107183036-107183058 GAAAGGAAACAAAATCCCCTTGG + Intergenic
937556548 2:123165127-123165149 GGATTCAAGTAAATTCCTCTGGG - Intergenic
939024500 2:136995821-136995843 ATATGGAAACATATTTCTCTGGG + Intronic
940495324 2:154420343-154420365 TAATGGAGACAAATTCATCTTGG - Intronic
941269435 2:163407432-163407454 GAATGGAAATGATTTCCTCTGGG - Intergenic
941343418 2:164336748-164336770 GAATGGAAACAGATTTCTCATGG - Intergenic
942214748 2:173707698-173707720 GAATGGCAAGAAATCCCTCTTGG + Intergenic
942818870 2:180086726-180086748 GGATGGAAATACGTTCCCCTTGG + Intergenic
942930887 2:181491131-181491153 GTATGGAAAAAAATTTATCTGGG + Intronic
943782144 2:191836618-191836640 GGATGAAAACAAATCCCTGGAGG - Exonic
944408921 2:199417346-199417368 GGATGTAAATGATTTCCTCTGGG - Intronic
945510009 2:210689425-210689447 GGCAGGAAACAAAATACTCTAGG - Intergenic
945795488 2:214357804-214357826 GGATTTAAAGAGATTCCTCTAGG + Intronic
948629526 2:239293169-239293191 CCATGGACACAAATTCCTCACGG - Intronic
1169987580 20:11462271-11462293 GGATGGGAACCAATTTCCCTGGG + Intergenic
1173606952 20:44338147-44338169 GGCTGGAAACCCATCCCTCTAGG - Intronic
1177122734 21:17157956-17157978 GTATGGAAATAAATTCCTGTAGG + Intergenic
1177233672 21:18357395-18357417 TGATGGAAAAAAATGCCTTTAGG + Intronic
1177243601 21:18493654-18493676 TGATGGGAACGAATTCTTCTGGG + Intergenic
1177707038 21:24719897-24719919 GAAAGCAAACAAATTCCACTGGG + Intergenic
1178216308 21:30603035-30603057 GAATGGAGACACATACCTCTTGG - Intergenic
1179587915 21:42385464-42385486 CGATGGACACAAACTCCTCCCGG + Exonic
949430704 3:3972564-3972586 GGCTGGAATCAAAGTGCTCTGGG + Intronic
949808886 3:7984734-7984756 GGAGGGAAACAAATTAATCCTGG + Intergenic
949813730 3:8036610-8036632 GGAAGAAAATAATTTCCTCTGGG + Intergenic
950930832 3:16787259-16787281 GGATGGATGACAATTCCTCTTGG - Intergenic
952015025 3:28946208-28946230 GCAAGGTACCAAATTCCTCTAGG + Intergenic
955521860 3:59783107-59783129 GGATGGAAACAAATTCCTCTGGG - Intronic
957188144 3:76970036-76970058 GGAAGAAAGGAAATTCCTCTGGG + Intronic
958960099 3:100501563-100501585 GGATGGAAACTCCTTCTTCTTGG + Intronic
959024507 3:101224983-101225005 AGATGGACACAAATCCCTCTAGG - Exonic
960800767 3:121537253-121537275 GGTTGGAAAAAAATTCTTCATGG - Intronic
961545809 3:127632161-127632183 GGAAGGAAACAGGCTCCTCTGGG + Intronic
961629321 3:128284665-128284687 GGAAGGGTACAAAATCCTCTGGG + Intronic
962148492 3:132867749-132867771 GGATGCATACAAATTACTCAAGG + Intergenic
962376516 3:134862927-134862949 GGATGGCCCCAAATTCCACTGGG - Intronic
962696420 3:137951906-137951928 GGAGGGAAACAACATACTCTGGG - Intergenic
962875918 3:139536041-139536063 TGCTGGGAACAAACTCCTCTGGG + Intronic
963718627 3:148833927-148833949 GGCTGGAGACAAATTGCTCTTGG - Intronic
965566196 3:170120813-170120835 GCATGGAAACAAACTCTTATGGG - Intronic
966281603 3:178237318-178237340 GAATGTAAACAAATAGCTCTAGG - Intergenic
967280341 3:187816347-187816369 GGATGGAAAGCCTTTCCTCTGGG - Intergenic
967858005 3:194132942-194132964 GGATGTAGACAGATGCCTCTGGG + Intergenic
967954975 3:194871037-194871059 GGTTTGCCACAAATTCCTCTTGG - Intergenic
968967365 4:3775861-3775883 GGATGGGAAGAAATTCCTCCAGG + Intergenic
970256995 4:14178613-14178635 GAATAGAAACCATTTCCTCTTGG - Intergenic
970264905 4:14271559-14271581 GGAAGGAATAAAATTGCTCTGGG - Intergenic
973714210 4:53658875-53658897 GGCTGGAAACAAAATCCTAGAGG - Intronic
974795862 4:66748405-66748427 GTAAAGAAACAACTTCCTCTGGG - Intergenic
975992270 4:80268807-80268829 ATATGGAAATAGATTCCTCTCGG - Intronic
977284730 4:95088513-95088535 GGAATAAAACAAATCCCTCTAGG - Intronic
978539508 4:109802194-109802216 TGGTGGAAACAAGTTCCTATTGG - Intergenic
980134091 4:128843923-128843945 GGATGTAAACTACTTCCTCATGG - Intronic
980155120 4:129094981-129095003 GGATGGAAGCAAATACCTTCTGG + Intronic
984489451 4:180414499-180414521 GGCAGGAAATATATTCCTCTAGG + Intergenic
985863991 5:2497326-2497348 TGATGGAAACATTTGCCTCTGGG - Intergenic
986462933 5:7991619-7991641 GGCAGGAACCAAATTCCTTTTGG + Intergenic
987292837 5:16524597-16524619 TGATAGAAACAAATTCTCCTTGG - Intronic
988441513 5:31239207-31239229 GGCTGGACACAATATCCTCTAGG - Intronic
991256883 5:64623849-64623871 GAATGGAAACAAATTCTCCATGG - Intergenic
991655080 5:68895913-68895935 GTATGCAAACTAATTGCTCTGGG - Intergenic
993258353 5:85622781-85622803 GGATGGGAAAAAATGCCTCCAGG - Intergenic
993479375 5:88404686-88404708 GTAAGGAAGCAAAATCCTCTTGG + Intergenic
993885404 5:93410235-93410257 GGATGGAACAAAATCCATCTGGG - Intergenic
995145547 5:108784345-108784367 GGATGGAACCCCATGCCTCTAGG + Intronic
995267118 5:110175193-110175215 CGATGGAGACAGATCCCTCTTGG + Intergenic
995568462 5:113455667-113455689 GTATGGCCCCAAATTCCTCTGGG - Intronic
995674046 5:114642293-114642315 TCATGGAAACAAACCCCTCTTGG - Intergenic
995838264 5:116419993-116420015 GGAAGAAAACAAATTCTTATTGG + Intergenic
996857486 5:128025394-128025416 GGATGCAAATATATTCCTTTAGG + Intergenic
997150502 5:131488775-131488797 GGAGGAAAACAAATCTCTCTAGG - Intronic
997765275 5:136496945-136496967 GGATTGGTACAAATTCTTCTTGG + Intergenic
999262107 5:150244690-150244712 GGATGGACAGCCATTCCTCTTGG - Intronic
1000620324 5:163477827-163477849 GAATTGAAAATAATTCCTCTAGG + Intronic
1000670755 5:164060196-164060218 GCATGGAAATAAATTCCAATGGG + Intergenic
1006373077 6:33657338-33657360 GGATGCAAACCAAATCCTCAAGG + Intronic
1006951447 6:37824101-37824123 GGATTAAAACAAATTTTTCTTGG + Intronic
1009658913 6:66584206-66584228 GGATTGAAATAAATCTCTCTAGG - Intergenic
1010802725 6:80196436-80196458 CAATGGGAACAAATTGCTCTGGG - Intronic
1012085580 6:94822279-94822301 GGAAGGAAACTAAGTTCTCTAGG - Intergenic
1012374141 6:98540662-98540684 AAATGTAAACAAATTCCTTTAGG - Intergenic
1012787106 6:103644897-103644919 GGATTTAAACAGATTTCTCTAGG + Intergenic
1014345955 6:120268971-120268993 GGAGGGAAATAAATCCCTGTAGG - Intergenic
1014505973 6:122256778-122256800 AGATGAATACAAATACCTCTTGG - Intergenic
1014783017 6:125586678-125586700 GCATAAAAACAATTTCCTCTAGG - Intergenic
1016492133 6:144617443-144617465 GTTTGGCAATAAATTCCTCTTGG + Intronic
1016563148 6:145419289-145419311 GGATGGAAAAATATTCTACTGGG + Intergenic
1021511232 7:21434727-21434749 GGGTGGAAAAAAATACCTGTTGG - Intronic
1022598849 7:31737975-31737997 GGAAGGAGACAAATCCCTATGGG - Intergenic
1025818149 7:64938416-64938438 GGATGTAAACTAATTTCTCCTGG - Intergenic
1027186003 7:75971347-75971369 GGTGGGAAACACCTTCCTCTGGG - Intronic
1027756933 7:82225698-82225720 GGTTGGATAGACATTCCTCTAGG - Intronic
1028459230 7:91072112-91072134 GGATGGAAACCTACTCATCTGGG - Intronic
1030030398 7:105364249-105364271 GGCTTGAAACAAATTCCTGCTGG - Intronic
1032569142 7:132981420-132981442 TAATGGAAACTAATTCCTATAGG - Intronic
1034320717 7:150179007-150179029 AGATTCAAACAAATTCTTCTGGG + Intergenic
1034772020 7:153788241-153788263 AGATTCAAACAAATTCTTCTGGG - Intergenic
1034788881 7:153950029-153950051 GAAAGGAAACATATTCCTGTGGG + Intronic
1035987635 8:4452333-4452355 GGCTCTAAACAAATTCCACTGGG + Intronic
1038489774 8:27962322-27962344 AGGTGAAAACAAATTCCTCGAGG + Intronic
1039384924 8:37127056-37127078 GCATAGAAACAAATTCCTGGTGG - Intergenic
1039680214 8:39727037-39727059 GGATGTATACAACTTTCTCTGGG - Intronic
1040960115 8:53022791-53022813 GGGTGGAAACAACTTGCCCTGGG - Intergenic
1041887035 8:62822015-62822037 GGCTGGAAAAAAATCCCTCCAGG + Intronic
1043408271 8:79962426-79962448 GGATGGTTACAAATCCCACTGGG - Intronic
1046603965 8:116350267-116350289 GGATGTAAGCAAAAACCTCTGGG - Intergenic
1047661411 8:127041024-127041046 GGTTGGAAACTCATTCATCTGGG + Intergenic
1050430411 9:5556410-5556432 GGATGGAGACAAATATCTGTGGG + Intronic
1052671656 9:31565444-31565466 GGATGCAAACTAATGTCTCTAGG + Intergenic
1053377485 9:37619940-37619962 GGATAGAAACAAATGAATCTGGG - Intronic
1056128554 9:83562067-83562089 GGATGGGATCAAATTGCTCCTGG + Intergenic
1059916875 9:119113712-119113734 GGATAAAAAAAAATACCTCTTGG + Intergenic
1059959021 9:119547053-119547075 GGATGGAAAGGAAGTACTCTGGG - Intergenic
1060209625 9:121701680-121701702 GGATGGGCAGAAATTTCTCTGGG + Intronic
1185695364 X:2190031-2190053 GGATGGGAAGATATTCCTTTTGG - Intergenic
1185848193 X:3459828-3459850 GGATTAGAACAAATTCCTCTGGG + Intergenic
1186351077 X:8740285-8740307 TGCTGGAAATAAATTCCTCAGGG - Intergenic
1186903979 X:14091208-14091230 GTATGGAAATAAATTCCTTTGGG + Intergenic
1190470152 X:50770583-50770605 GCATGGAAATAATTTACTCTGGG - Intronic
1190964401 X:55284675-55284697 GGATGGCAACCATTTCTTCTGGG + Intronic
1191153378 X:57243931-57243953 GGATAATAACAAACTCCTCTGGG + Intergenic
1195576129 X:106453072-106453094 AGATGCAAACAAACTGCTCTAGG - Intergenic
1195795701 X:108644596-108644618 GAATTTAAACAACTTCCTCTCGG + Intronic
1196119232 X:112030642-112030664 GGATAGAAGCAGATTCCTCCAGG - Intronic
1196623177 X:117847580-117847602 AGAAGGAAACAAATGCCCCTAGG + Intergenic
1199084731 X:143615624-143615646 GGACGGAAACAAATTCGGCCAGG - Intergenic
1199587128 X:149427000-149427022 GGATTGGTACAAATTCTTCTTGG - Intergenic
1199848816 X:151710828-151710850 GGCAGGAAACAAACCCCTCTGGG + Intergenic
1200749507 Y:6932096-6932118 GGAAGGAAAGAATTTCCACTGGG - Intronic
1200815665 Y:7529608-7529630 GGATTAGAACAAATTCCTCTGGG - Intergenic
1202105604 Y:21361059-21361081 TCTTGGAAACATATTCCTCTTGG - Intergenic