ID: 955528578

View in Genome Browser
Species Human (GRCh38)
Location 3:59848116-59848138
Sequence ATGGCTTGTGGGAGCCACGG TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 186
Summary {0: 1, 1: 0, 2: 2, 3: 13, 4: 170}

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
955528578_955528590 29 Left 955528578 3:59848116-59848138 CCACCGTGGCTCCCACAAGCCAT 0: 1
1: 0
2: 2
3: 13
4: 170
Right 955528590 3:59848168-59848190 CTGCCATGGGGCTGAAAGATGGG 0: 1
1: 0
2: 2
3: 31
4: 200
955528578_955528591 30 Left 955528578 3:59848116-59848138 CCACCGTGGCTCCCACAAGCCAT 0: 1
1: 0
2: 2
3: 13
4: 170
Right 955528591 3:59848169-59848191 TGCCATGGGGCTGAAAGATGGGG 0: 1
1: 0
2: 6
3: 35
4: 212
955528578_955528589 28 Left 955528578 3:59848116-59848138 CCACCGTGGCTCCCACAAGCCAT 0: 1
1: 0
2: 2
3: 13
4: 170
Right 955528589 3:59848167-59848189 CCTGCCATGGGGCTGAAAGATGG 0: 1
1: 0
2: 5
3: 31
4: 272
955528578_955528585 15 Left 955528578 3:59848116-59848138 CCACCGTGGCTCCCACAAGCCAT 0: 1
1: 0
2: 2
3: 13
4: 170
Right 955528585 3:59848154-59848176 ACATGCACAGCTGCCTGCCATGG 0: 4
1: 8
2: 17
3: 54
4: 248
955528578_955528586 16 Left 955528578 3:59848116-59848138 CCACCGTGGCTCCCACAAGCCAT 0: 1
1: 0
2: 2
3: 13
4: 170
Right 955528586 3:59848155-59848177 CATGCACAGCTGCCTGCCATGGG 0: 2
1: 11
2: 22
3: 58
4: 239
955528578_955528587 17 Left 955528578 3:59848116-59848138 CCACCGTGGCTCCCACAAGCCAT 0: 1
1: 0
2: 2
3: 13
4: 170
Right 955528587 3:59848156-59848178 ATGCACAGCTGCCTGCCATGGGG 0: 3
1: 12
2: 24
3: 66
4: 279

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
955528578 Original CRISPR ATGGCTTGTGGGAGCCACGG TGG (reversed) Intronic
900196360 1:1377970-1377992 GTAGCTTGTGGGAGCCAGTGTGG - Intergenic
900400436 1:2470822-2470844 CAGGCTCGTGGCAGCCACGGTGG - Intronic
904449473 1:30601720-30601742 ATGGCCTGTGGGAACCAGGCAGG + Intergenic
904604351 1:31690729-31690751 ATGGCTTGGGTTAGACACGGAGG - Intronic
904963373 1:34352200-34352222 ATGGGCTGTGGGAGCCACCAGGG + Intergenic
905259355 1:36706566-36706588 ATGGCTGGTGAGAGGCGCGGGGG + Intergenic
906373585 1:45275166-45275188 ATAGCTTGTGGGAGCCAGGATGG + Intronic
906529101 1:46512955-46512977 ATGGCTGGAGTGAGCCGCGGAGG - Exonic
908374498 1:63521690-63521712 GTGGCATGTGGGAGCCCAGGAGG + Intronic
909879748 1:80859573-80859595 ACAGCTTGTGGGAGGCAGGGTGG + Intergenic
910170200 1:84369009-84369031 AAGGCTTCTGGGAGCCACCAAGG - Intronic
910564705 1:88630589-88630611 ATGCCTTTGGGGAGCCAAGGCGG + Intergenic
911925790 1:103830777-103830799 GCTGCTTGTGGGAGCCAGGGTGG - Intergenic
912637005 1:111305465-111305487 AGAGCTTGTGGGAGCCAGGGTGG - Intronic
914193702 1:145432346-145432368 ATGTCGTATGGGAGACACGGAGG - Intergenic
914475031 1:148015236-148015258 ATGTCGTATGGGAGACACGGAGG - Intergenic
918153962 1:181826527-181826549 ACAGTTTGTGGGAGCCAAGGTGG + Intergenic
919923833 1:202181961-202181983 CTGCCTTGTGGGGGCCATGGTGG + Intergenic
920989533 1:210923452-210923474 ATGGATTGTGGTGGCCACTGAGG - Intronic
923559712 1:235029318-235029340 ATGCCTAGTGGAAGCCACAGAGG - Intergenic
1063541156 10:6935239-6935261 ATGGCTGGTGGAAGGCACTGGGG + Intergenic
1067692170 10:48508914-48508936 ATGCCTTGTGGGTACCACTGGGG + Intronic
1068171827 10:53404193-53404215 CTGGAGTGTGGCAGCCACGGTGG + Intergenic
1071450447 10:85787899-85787921 ATGGATTCTGTGAGCCACTGGGG - Intronic
1072173211 10:92887945-92887967 ATGGGTTGTGGGTGACACGTGGG + Intronic
1072703149 10:97659644-97659666 ATAGCTTGAGGGTGCCAAGGTGG - Intronic
1073289997 10:102408821-102408843 GCGGCTTGTGGGAGGCACCGAGG - Intronic
1074855961 10:117473652-117473674 ATGGCTTGGAGGAGCCAGTGGGG + Intergenic
1076491452 10:130864272-130864294 CTGGCTCGTAGGAGCCACTGGGG + Intergenic
1076525939 10:131112408-131112430 AGGGCTTGTGGGAGGCACAGTGG - Intronic
1076566328 10:131401993-131402015 AGGGATTGTGGGGGCCATGGAGG + Intergenic
1076730488 10:132436552-132436574 CTAGCTGGTGGGAGCCAAGGTGG + Intergenic
1079151342 11:17902390-17902412 ATGGCTGGTGGAAGCCACAAGGG + Intronic
1084963049 11:72727238-72727260 ATGGCTTGAGAGAGCCATGCAGG - Intronic
1085299955 11:75452043-75452065 GTGGCTTGTGATAGCCATGGTGG + Intronic
1085474001 11:76777896-76777918 ACAGCTTGTGAGAGCCAGGGTGG - Intergenic
1085491035 11:76917424-76917446 ATGACTTAGGGCAGCCACGGTGG + Intronic
1089383273 11:118051295-118051317 CTGGCTTGTGGGAGACCCAGGGG - Intergenic
1097180240 12:57167683-57167705 ATGCCTGGAGGGAGCCACGATGG + Intronic
1099822316 12:87728396-87728418 ATGCCTAGTGGGAGACAAGGGGG - Intergenic
1101343080 12:103860316-103860338 ATGTCTTGTGTGAGGCACTGAGG + Intergenic
1101991127 12:109486087-109486109 AGAGCTTGTGGGAGACACTGCGG - Intronic
1106602340 13:31199120-31199142 AAGGCTTGAGGGAGGCACGAAGG + Intergenic
1113849321 13:113409034-113409056 ATGGCTTAGAGGAGCCACTGAGG + Intergenic
1115180693 14:30622320-30622342 GTGGCTCGTGGGAGCCAAGATGG + Exonic
1115397016 14:32919836-32919858 ATGGCCTGTGGCCGCCAGGGAGG + Intergenic
1116188791 14:41636084-41636106 ATGACATTTGGGAGCCACTGAGG + Intronic
1117747243 14:58882322-58882344 ATTACTGGTGGGAGCCACCGAGG + Intergenic
1117913661 14:60656403-60656425 CCCGCTTGTGGGAGCCACAGGGG - Intronic
1119731058 14:76951311-76951333 GTGGCTTGTGGGGCCCACGAGGG - Intergenic
1120054232 14:79903747-79903769 AGAGCTTGTGGGAGCCAAGGTGG - Intergenic
1123976751 15:25560935-25560957 ATGGATTCTGGGATCCAGGGGGG + Intergenic
1125967826 15:43888384-43888406 AGGGCCTGTGGGACCCACTGAGG + Intronic
1125994776 15:44147891-44147913 ATAGCTTGCAGGAGCCAGGGTGG + Intronic
1126162594 15:45628160-45628182 ATAGCTTGTGGGAGCCAGGGTGG - Intronic
1130603767 15:85296662-85296684 AAGCTTTGTGGGAGCCACAGTGG - Intergenic
1131010132 15:89010472-89010494 ATGGCTAGTGGCTACCACGGTGG + Intergenic
1132931739 16:2462250-2462272 TGGGCTTGTGGGAGCCCTGGGGG + Intronic
1132992755 16:2805520-2805542 ATGGATTGGGGGTGCCATGGAGG + Intergenic
1133267239 16:4592401-4592423 AGGGCTTGTGGGGCCCATGGAGG + Intronic
1133965449 16:10527968-10527990 AATGCTTTTGGGAGCCAAGGTGG + Intergenic
1134002994 16:10797270-10797292 ATGGCCTTTGGGAGCCACTTTGG + Intronic
1136461595 16:30414415-30414437 ATGGCCAGTGGGAGCCAGGATGG - Intronic
1141820678 16:86443294-86443316 ATGGCGTGTGGGGGACACTGTGG + Intergenic
1143781479 17:9231777-9231799 AAGCCTTCTGGGAGCCCCGGAGG + Intronic
1144830864 17:18130540-18130562 TTGGCTGGTGGTAGCCATGGGGG + Intronic
1145030683 17:19502528-19502550 AAGGCTTCAGGGAGCCACGAAGG + Intronic
1146185991 17:30724570-30724592 ATGGCTGGAGGGAGACAAGGCGG + Intergenic
1147546754 17:41407919-41407941 ATGGGTAGTGGGAGCCAAGCTGG + Intergenic
1152403438 17:80083086-80083108 ATGCCTAGGGGGAGCCAGGGTGG + Intronic
1152741042 17:82018468-82018490 AGGGGTTGGGGCAGCCACGGGGG - Intergenic
1153151870 18:2105148-2105170 GTGGCATGTGGGAGCCATGAGGG - Intergenic
1153421488 18:4911221-4911243 ATAGCTTGTGGGAACCAGGGTGG + Intergenic
1155671751 18:28379947-28379969 AGAGCTTGTGGGAGGCAGGGTGG + Intergenic
1156236983 18:35215296-35215318 ATAGCTTGTGGAAGCCAAGGAGG - Intergenic
1156553139 18:38039637-38039659 GTGCCTTGTGGGAGCCCTGGGGG + Intergenic
1160031965 18:75269816-75269838 GTGGCTGCTGGGAGCCAGGGGGG - Intronic
1160827123 19:1085791-1085813 GTGGCTTCTGGCAGCCACAGCGG + Exonic
1161243312 19:3234979-3235001 AAGGGAGGTGGGAGCCACGGAGG - Intronic
1161283153 19:3456492-3456514 AGGGGTTGTGGGAGCCGGGGCGG - Intronic
1161431254 19:4233592-4233614 AAGGCAGGTGGGAGCCATGGAGG - Intronic
1162972786 19:14191161-14191183 ATGGCTGGAGGGAGACAAGGCGG - Intronic
1163485034 19:17580477-17580499 AGGGCGTGAGGGAGCCATGGAGG - Intronic
1164951044 19:32337432-32337454 ATGGCTTGTTGGAAACAGGGTGG - Intergenic
1167411515 19:49346963-49346985 ATGTCTAGTGGGATCCAGGGAGG + Intronic
925713877 2:6767596-6767618 ATGGCTTCTGGGAGCAACTGTGG + Intergenic
927149262 2:20186349-20186371 ATGGGGAGTGGGAGCCAGGGTGG - Intergenic
928167445 2:28981399-28981421 GTGGCTGGTGGGGGCCAGGGTGG + Exonic
933461775 2:82597078-82597100 ACAGCTTGTGGGAGCCAAGTTGG - Intergenic
933551347 2:83781027-83781049 ATAGCTTGTGGGAGCCAGAGAGG + Intergenic
933917685 2:87012905-87012927 ATGGATTTTGGTAGCCACAGGGG + Exonic
934005311 2:87757012-87757034 ATGGATTTTGGTAGCCACAGGGG - Exonic
934721435 2:96579751-96579773 AAGGCCTGTGGGAGCCCAGGGGG + Intergenic
935768270 2:106391099-106391121 ATGGATTTTGGTAGCCACAGGGG - Intergenic
935809194 2:106780092-106780114 ACAGCTTGTGGGAGCCAGGGTGG - Intergenic
937442970 2:121932603-121932625 ATGTCTTGTGCGTGCCATGGAGG + Intergenic
938324157 2:130386540-130386562 ATGGCTTGTGGCAGCCATGCTGG + Intergenic
939033954 2:137109176-137109198 ATAGGCTGTGGGAGCCAGGGAGG - Intronic
941034396 2:160552245-160552267 ATGGATTTTGGTAGCCAAGGAGG + Intergenic
941594688 2:167461181-167461203 ATGGCTTGTGGGGCCCAGAGTGG - Intergenic
948609926 2:239160371-239160393 GTGGCTTGTGGCAGCCACACTGG + Intronic
948916915 2:241039139-241039161 ATGGGTTCTGGGGGCCAAGGTGG - Intronic
1169566963 20:6865237-6865259 ATATCTTTTTGGAGCCACGGAGG - Intergenic
1170386358 20:15821822-15821844 GTGGCTTTTGGGATCCAAGGGGG + Intronic
1170657155 20:18298571-18298593 ATGGCTTGTGGGAGACATGGTGG + Intronic
1171215039 20:23346167-23346189 GTGGCTTGTGTGAACCACCGTGG - Intergenic
1172330969 20:34075820-34075842 ATGGCTTGTGGCCACCAGGGCGG - Intronic
1173905329 20:46624107-46624129 ATGCCTTGTGGGAGACAGTGAGG - Intronic
1174252578 20:49230711-49230733 AGGCCCTGTGGGAGCCACGCTGG - Intronic
1174502263 20:50994003-50994025 AGGGATTCTGGCAGCCACGGTGG + Intergenic
1175831082 20:61965808-61965830 GTGCCTTGTGGGAGCCGAGGAGG - Intronic
1175898944 20:62352452-62352474 TTGGCCTGTGGGAGCCTCAGTGG - Intronic
1176030412 20:63008711-63008733 AGGGCTGGTGGGGGCCATGGGGG + Intergenic
1176309174 21:5140735-5140757 AGGACTTGTGGAAGCCACGCTGG + Intronic
1177634640 21:23771622-23771644 ATGGCTTTTGTCAGCCATGGTGG + Intergenic
1179847887 21:44121298-44121320 AGGACTTGTGGAAGCCACGCTGG - Intronic
1180174279 21:46080188-46080210 GTGCCTTGTGGGTGCCCCGGGGG + Intergenic
1180198983 21:46213579-46213601 AGGGCTTGTGGAAGCCACTGAGG - Intronic
1181752351 22:24997561-24997583 ATGGCTTGTGGGAGGCTGGTGGG + Intronic
1182039194 22:27223251-27223273 ATGCCTAGTGGGAGAGACGGAGG + Intergenic
1184916747 22:47574655-47574677 CTGTCTTGTGGCATCCACGGTGG + Intergenic
952435550 3:33269490-33269512 AGGGCTTGTTGCAGCCACTGTGG + Intergenic
953473703 3:43188213-43188235 AGGGTTTGTGGGAGACACAGAGG + Intergenic
954351459 3:50047629-50047651 TTGGCTGGTGGGAGCAACAGCGG - Intronic
955528578 3:59848116-59848138 ATGGCTTGTGGGAGCCACGGTGG - Intronic
957273313 3:78058927-78058949 ATGCCTCATGGGAGACACGGGGG + Intergenic
957733097 3:84168169-84168191 GCAGCTTGTGGGAGCCAGGGTGG - Intergenic
957960025 3:87237219-87237241 ATGAATTGTGGGAGGCAGGGGGG - Intronic
961738057 3:129014721-129014743 ATGACTTGTGTGATCCAGGGCGG + Intronic
962753472 3:138451304-138451326 GGGGCTTCTGGGAGCCAAGGTGG + Intronic
965083722 3:164067319-164067341 ATAGCTTGCAGGAGCCACAGTGG - Intergenic
968238790 3:197055962-197055984 AGGGTTTGTGGGAGCCAGTGTGG - Intronic
973865703 4:55110712-55110734 ATCTCTGGTGGAAGCCACGGTGG - Exonic
973895652 4:55410075-55410097 AAGGCTGGTGGGAGGCAAGGAGG - Intronic
974690749 4:65294246-65294268 ATGGCTTGGAGGAGCCAAGATGG - Intergenic
979521158 4:121668552-121668574 ATGGCTTCTGTGAGTCATGGAGG - Intronic
980228807 4:130021453-130021475 ATGGATTTTGGTATCCACGGAGG - Intergenic
981505842 4:145498943-145498965 ACGGCTTGAGAGAGCCACAGGGG - Intronic
981790181 4:148527329-148527351 ATGGCTTGTGCCAGCCAGGAAGG + Intergenic
982289247 4:153763517-153763539 AAGGCTGGAGGGAGCCACTGCGG - Intergenic
988683172 5:33503010-33503032 CTGGATTGTGGGTGCCACGCTGG + Intergenic
992753567 5:79883389-79883411 ACAGCTTGTGGGAGCCAGGGTGG - Intergenic
995608552 5:113884906-113884928 ACAGCCTATGGGAGCCACGGTGG - Intergenic
1000407068 5:160899380-160899402 AAGGCTTTTGGGAGACAGGGTGG + Intergenic
1001313577 5:170627731-170627753 GAGGCTTGTAGGAGCCAAGGTGG + Intronic
1002452293 5:179325847-179325869 ATGGCCTGTGGGAGGGACAGGGG + Intronic
1002572786 5:180153295-180153317 ACAGCCTGTGGGAGCCAGGGTGG - Intronic
1003619506 6:7685705-7685727 ATGGTTTGTGGAAGCCAAGGAGG + Intergenic
1008632098 6:53371881-53371903 TTGGCTTCTGCCAGCCACGGTGG + Intergenic
1011379519 6:86727512-86727534 ATGACCAGTGGGAGCCACAGAGG - Intergenic
1018129111 6:160711270-160711292 ATGGATTTTGGTAGCCACAGGGG - Intronic
1018606168 6:165600176-165600198 GTGGTTTGTGGGATCCTCGGAGG - Intronic
1019215445 6:170440025-170440047 ATGGCATGTGGAGGCCACGTGGG + Intergenic
1019595170 7:1855004-1855026 CTGGCCTGTGGGAGGCACGTGGG + Intronic
1021761991 7:23911086-23911108 ATGGATTTTGGGGGCCAAGGTGG + Intergenic
1023669637 7:42561912-42561934 AGGGCTTGTTGTAGCCACAGTGG - Intergenic
1024587786 7:50856455-50856477 GGGGCTTGAGGGTGCCACGGAGG - Intergenic
1025741095 7:64196374-64196396 ATGGCTAATGGCAGCTACGGGGG + Intronic
1025943973 7:66092541-66092563 ATGGCATCTGGGTGCCAGGGAGG - Exonic
1026158186 7:67845946-67845968 GTGGGTGGTGGGAGCCACTGGGG + Intergenic
1026558134 7:71425762-71425784 ATGTATTGTGGGTGCCATGGAGG + Intronic
1029515286 7:101019824-101019846 AGGGCCTGTAGGAGCCAGGGGGG - Intergenic
1034965594 7:155388822-155388844 TTGGCTTCCGGGAGCCACTGAGG - Intronic
1037601128 8:20395136-20395158 ATGGCTTCTGGAAGCCACTAAGG - Intergenic
1040031645 8:42830263-42830285 TTGACTTGTGGAAGCCAAGGTGG - Intergenic
1040372272 8:46788585-46788607 ATAGTTTGTGGGACCCATGGAGG + Intergenic
1044581373 8:93829593-93829615 ATTTCTTGTGGGAACCACAGAGG - Intergenic
1048081754 8:131135645-131135667 TTGGCTTGTGGTATCCATGGGGG + Intergenic
1051288526 9:15521484-15521506 ATGGATTATGGTATCCACGGGGG + Intergenic
1057706442 9:97398383-97398405 GTGGCTTGGGGGAGCCCTGGAGG - Intergenic
1058174657 9:101723047-101723069 ATGTGTTGTGGGAGGCACGCAGG + Intronic
1058347318 9:103979673-103979695 GTGGGATGTGGCAGCCACGGTGG - Intergenic
1060045460 9:120336850-120336872 ATGTCCTGTGGGAGGCACTGGGG - Intergenic
1060183720 9:121551309-121551331 ATGGCATGTGGGAACCTCAGAGG - Intergenic
1061061775 9:128254170-128254192 ATGGCTGGAGGGAGCGCCGGAGG - Intronic
1061577160 9:131514315-131514337 AGGGCTGGGGGGAGCCAGGGTGG - Intronic
1062032928 9:134370176-134370198 ATGGCTTTGAGGAGCCCCGGAGG + Intronic
1203698449 Un_GL000214v1:117135-117157 ATGGGCTGTGGCAGCCACGTGGG + Intergenic
1203699366 Un_GL000214v1:123286-123308 ATGGGCTGTGGCAGCCACGTGGG + Intergenic
1203700310 Un_GL000214v1:129569-129591 ATGGGCTGTGGCAGCCACGTGGG + Intergenic
1203701232 Un_GL000214v1:135589-135611 ATGGGCTGTGGCAGCCACGTGGG + Intergenic
1203568020 Un_KI270744v1:108280-108302 ATGGGCTGTGGCAGCCACGTGGG + Intergenic
1203569657 Un_KI270744v1:119523-119545 ATGGGCTGTGGCAGCCACGTGGG + Intergenic
1187510188 X:19910637-19910659 GTGGCTTTTGGTAGCCACAGTGG + Intergenic
1189698654 X:43693667-43693689 ATAGCTTGTGAGGGCCACTGAGG - Intronic
1193255377 X:79342527-79342549 AGGGCTAGTGGCAGCCACTGTGG - Intergenic