ID: 955537357

View in Genome Browser
Species Human (GRCh38)
Location 3:59938462-59938484
Sequence TGTATGTTAGATCTCTAGAC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 115
Summary {0: 1, 1: 0, 2: 2, 3: 11, 4: 101}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
955537357_955537360 14 Left 955537357 3:59938462-59938484 CCAGTCTAGAGATCTAACATACA 0: 1
1: 0
2: 2
3: 11
4: 101
Right 955537360 3:59938499-59938521 GGTAAAACTGTACTGTATTTGGG 0: 1
1: 0
2: 2
3: 28
4: 244
955537357_955537358 -7 Left 955537357 3:59938462-59938484 CCAGTCTAGAGATCTAACATACA 0: 1
1: 0
2: 2
3: 11
4: 101
Right 955537358 3:59938478-59938500 ACATACAACATGAAGACTGCAGG 0: 1
1: 0
2: 0
3: 14
4: 183
955537357_955537359 13 Left 955537357 3:59938462-59938484 CCAGTCTAGAGATCTAACATACA 0: 1
1: 0
2: 2
3: 11
4: 101
Right 955537359 3:59938498-59938520 AGGTAAAACTGTACTGTATTTGG 0: 1
1: 0
2: 1
3: 15
4: 214

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
955537357 Original CRISPR TGTATGTTAGATCTCTAGAC TGG (reversed) Intronic
903403753 1:23079197-23079219 TGTACATCAGATCTGTAGACAGG - Intronic
907836152 1:58110470-58110492 TGTATGTCAGATACCTAGCCTGG - Intronic
911846678 1:102761530-102761552 AGTATGTTAAATCTCTAAAATGG - Intergenic
912183083 1:107241974-107241996 AGTATGTTTGATCTTTAGGCCGG + Intronic
917755896 1:178097581-178097603 TGTAGGTTAGGTCTCAAAACTGG - Intronic
921534109 1:216324088-216324110 AGTATGCTAGCTCTCTAGGCTGG - Intronic
921692659 1:218168310-218168332 TGTATTTCTGATCTCTAGAGTGG + Intergenic
921865510 1:220083712-220083734 GGTATGTAAAATCTGTAGACAGG + Intronic
922149843 1:222990283-222990305 TGTATTTTATATCTCTTTACAGG + Intronic
923351027 1:233106840-233106862 TGTAAGTTAGATATCCAGAGAGG - Intronic
924810449 1:247396622-247396644 TGTATGTGATATCTCAAAACTGG - Intergenic
1064918496 10:20489062-20489084 TGTAGGTTAGATATCTAAAATGG + Intergenic
1066205216 10:33182400-33182422 TTTATGTTCCACCTCTAGACTGG + Intronic
1066530543 10:36333435-36333457 AGGATGTTAGATTTCTAGTCAGG - Intergenic
1072367293 10:94725731-94725753 TATATATTATATCTATAGACAGG - Intronic
1086664590 11:89464724-89464746 TGTATCTTAGATACCTTGACAGG - Intronic
1087457007 11:98399401-98399423 TGTATGACAGATTTCTAAACTGG + Intergenic
1091000847 11:131910080-131910102 TATATGGCAGATCTCTAGAATGG + Intronic
1091862929 12:3803106-3803128 TGGAAGATAGATCACTAGACTGG + Intronic
1092321443 12:7480590-7480612 TGTACATTAGACCTCTAGACTGG - Intronic
1098349051 12:69538287-69538309 GGTAGGTTAGATGTCCAGACTGG - Intronic
1099553889 12:84084419-84084441 TTTATGTTATATCTTTAAACTGG + Intergenic
1101819513 12:108173139-108173161 TGTGTCTTAGCCCTCTAGACTGG - Intronic
1108044403 13:46369526-46369548 TGGATTTTATTTCTCTAGACAGG - Intronic
1108790093 13:53959452-53959474 TATATGTTAGATCTATAAAAGGG + Intergenic
1109591764 13:64493061-64493083 TGTATGTTTCTTCTCTAAACAGG - Intergenic
1111333126 13:86787234-86787256 TGTATGGTAGATCTTTAGTGTGG - Intergenic
1112221788 13:97498441-97498463 TCTATTTCAGATCTCTTGACAGG + Intergenic
1114075816 14:19160617-19160639 TGTATCTTAGATATCCAGATAGG + Intergenic
1114086347 14:19238955-19238977 TGTATCTTAGATATCCAGATAGG - Intergenic
1115903731 14:38183936-38183958 TGTAAGCTAGATCTCTTGAGGGG + Intergenic
1202897890 14_GL000194v1_random:20574-20596 TGTATCTTAGATATCCAGATAGG - Intergenic
1125929296 15:43589115-43589137 TCTATGTTAGATCTGGAGAAGGG + Intronic
1125942463 15:43688947-43688969 TCTATGTTAGATCTGGAGAAGGG + Intergenic
1127404945 15:58633838-58633860 TGTATGTCATATCTCAGGACAGG - Intronic
1131472129 15:92706639-92706661 GGTCTGTTAGATTTCTAGATTGG - Intronic
1131586442 15:93700185-93700207 TTTATATTAAATCTTTAGACTGG - Intergenic
1141016184 16:80452260-80452282 TGTATGTGAGATGTCTAGTTAGG - Intergenic
1150503753 17:65677177-65677199 TGTATGTGAGATTTACAGACAGG - Intronic
1153302715 18:3605681-3605703 TGAATGTCAGATCTGTAAACAGG + Intronic
1153676004 18:7456136-7456158 TGAATGTGAGATCTATAGGCTGG - Intergenic
1154367363 18:13723480-13723502 TGTAGGGTAGATCTACAGACAGG + Intronic
1160084293 18:75760442-75760464 TGTACATTACATCTCTAGACTGG + Intergenic
1165097507 19:33417604-33417626 TGTATGTTAAATCATTCGACTGG - Intronic
925741790 2:7011343-7011365 TGTATGTTATATCTCTAAACTGG + Intronic
927436892 2:23074292-23074314 TGTAGTTTACATCACTAGACTGG + Intergenic
929018199 2:37523271-37523293 TGTAAATTAGATCTCTACAGAGG + Intergenic
932453715 2:71832532-71832554 TGTATGTCAGATCCCTAGCAAGG + Intergenic
935966802 2:108486267-108486289 TGTATGTTAAATATGTAGTCTGG + Intronic
937785443 2:125889594-125889616 TGTATGTCAGATCTCATGATGGG - Intergenic
938490410 2:131758135-131758157 TGTATCTTAGATATCTAGATAGG + Intronic
939908977 2:147956200-147956222 TTTATGTTAGATCTCTCAACTGG - Intronic
941705623 2:168655777-168655799 TATACATTAGGTCTCTAGACTGG - Intronic
946884589 2:224210476-224210498 TTTAAATTAGATCTCTAGTCAGG - Intergenic
1173086852 20:39928540-39928562 TGAATGTTAGTTCTTTAGAAAGG - Intergenic
1173719792 20:45246244-45246266 TGTATGTCAGCTCTCTAAAAAGG - Intergenic
1177506199 21:22020741-22020763 TGTATGTTAGTTCTATAAAATGG + Intergenic
1177557687 21:22713533-22713555 AGCATGTTAAATCTCTAGCCAGG - Intergenic
1178888149 21:36498412-36498434 TGTATTTTACATCTCTTGTCTGG + Intronic
1180291516 22:10853781-10853803 TGTATCTTAGATATCCAGATAGG + Intergenic
1180494321 22:15883203-15883225 TGTATCTTAGATATCCAGATAGG + Intergenic
955537357 3:59938462-59938484 TGTATGTTAGATCTCTAGACTGG - Intronic
958692250 3:97482934-97482956 TCCATTTTAGATCTCTAGACAGG - Intronic
959053203 3:101543956-101543978 TGTATGTTACATCTTTATAATGG + Intergenic
963646930 3:147926678-147926700 TCTATGTTATTTCTCTAGAATGG + Intergenic
963982076 3:151549550-151549572 TGAAAGTTAAATCTCAAGACTGG - Intergenic
965236050 3:166124962-166124984 TATATGTTAAATCTCTGTACTGG - Intergenic
965892478 3:173531754-173531776 TGTAAGGTAGAGCTTTAGACTGG - Intronic
965981173 3:174692954-174692976 TGTATGTTGAATCTCAAGAAAGG - Intronic
966323375 3:178726968-178726990 TGTTTTTTAGATCTCTAGCCAGG - Intronic
968853019 4:3096203-3096225 TGTATTTTAGCTCTGTAGTCCGG - Intronic
971429443 4:26549394-26549416 TGTGTGTTTGATTTCAAGACAGG + Intergenic
972605198 4:40607282-40607304 TTTATGTGAGATGTCCAGACAGG + Intronic
972670493 4:41210248-41210270 TGCATCACAGATCTCTAGACTGG + Intronic
975012110 4:69368662-69368684 TGTATGTTATATTTCCAGAATGG + Intronic
975589304 4:75984505-75984527 TTTATGCTAGAGCTCTAGGCAGG + Intronic
977306963 4:95335763-95335785 TGTATGTTAGATCTATTGACTGG + Intronic
982595772 4:157381411-157381433 TTTATGTAAGATCTCCAGAGTGG + Intergenic
983142466 4:164169000-164169022 TGTACATTAGATCTCTAAACTGG - Intronic
984534842 4:180961552-180961574 TTTATCTTAGATCTACAGACAGG - Intergenic
984806905 4:183759173-183759195 TGTATGTGAAATGTCCAGACTGG + Intergenic
986323171 5:6650206-6650228 TCTATGTCTGATCTCTAGTCTGG - Intronic
996289965 5:121840956-121840978 TGTAAATTAGAATTCTAGACAGG - Intergenic
997893193 5:137693495-137693517 TGTATGTTTGATCTAGAGGCAGG - Intronic
999511093 5:152252517-152252539 TGTACCTTAGGTCTCTAGACTGG + Intergenic
1000440579 5:161258564-161258586 TGTAGGTAAGTTCTCAAGACTGG + Intergenic
1001210511 5:169806550-169806572 TGTATGTTAAATCCTCAGACTGG + Intronic
1007211890 6:40199147-40199169 TGTACATTAGAGCTCTAGACTGG + Intergenic
1009404213 6:63292246-63292268 TGTATGTTAGAAGTCTAGGTTGG - Intronic
1012080104 6:94746983-94747005 TTCATGTTAGATCTTTAGATAGG + Intergenic
1012574525 6:100776465-100776487 TGTATGTAAGATCAGTAGTCTGG - Intronic
1014633180 6:123812671-123812693 TGTATCCTACATCTCTAGGCAGG + Intronic
1023222788 7:37937249-37937271 TGTTTGTTAGATCTTTAGTTTGG - Intronic
1024563988 7:50666492-50666514 TGTATCTTACATGTCTAGAAAGG + Intronic
1034531865 7:151700864-151700886 TGGATGTTTGACCTCTAAACGGG - Intronic
1039150833 8:34503520-34503542 TGTCTGTTGTATCTCTAGAATGG - Intergenic
1042271317 8:66958806-66958828 TGTATTTCAGATCTCTACATTGG - Intronic
1044111224 8:88277587-88277609 TGTATGTTATATTTCAAGTCTGG - Intronic
1051773925 9:20613879-20613901 TTTATGTTAAATTTCTAGAAGGG - Intronic
1052149416 9:25095629-25095651 TGTATGTAACATCTCTAAATAGG - Intergenic
1053605645 9:39655909-39655931 TGTAAATCAGATCTCTAGATGGG - Intergenic
1054349990 9:64012552-64012574 TGTATCTTAGATATCCAGATAGG - Intergenic
1055440955 9:76335427-76335449 TGTATGTTAAATCTCTGGCTTGG + Intronic
1058178109 9:101762416-101762438 TCTATGTTAGATACCTAGATTGG - Intergenic
1059358669 9:113721291-113721313 TGTATGATAGATCTCTTGAAAGG + Intergenic
1185720974 X:2381173-2381195 TGTAGGTTATGTCTCAAGACAGG - Intronic
1186598471 X:11009973-11009995 TATCTGTGAGATCTCTAGAGAGG - Intergenic
1186874736 X:13805758-13805780 TGTATTTTAGTTCACTAAACTGG - Intronic
1187655296 X:21464515-21464537 TGGATGTTTTATCTCTAGAAAGG - Intronic
1191741839 X:64444522-64444544 TGTATGTCAGAAATCTAGATGGG + Intergenic
1193590191 X:83379994-83380016 TGTTTGTTAGATCGCTAGAGTGG - Intergenic
1193848533 X:86506087-86506109 TGTATGTTAGAAGTCTGGATGGG + Intronic
1193959298 X:87903698-87903720 TGTATGGTAGCTCTCTATAGAGG + Intergenic
1200330005 X:155285631-155285653 TGTATATTAGATCTGTTGCCTGG + Intronic
1201150966 Y:11095401-11095423 TGTATCTTAGATATCCAGATAGG - Intergenic