ID: 955538131

View in Genome Browser
Species Human (GRCh38)
Location 3:59946463-59946485
Sequence CGGGAAGTTAAACCATCTGT TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 42
Summary {0: 1, 1: 0, 2: 0, 3: 2, 4: 39}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
955538131_955538135 27 Left 955538131 3:59946463-59946485 CCAACAGATGGTTTAACTTCCCG 0: 1
1: 0
2: 0
3: 2
4: 39
Right 955538135 3:59946513-59946535 TTTCTCTTGACTGATTGCTCTGG 0: 48
1: 1767
2: 5630
3: 6942
4: 7718

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
955538131 Original CRISPR CGGGAAGTTAAACCATCTGT TGG (reversed) Intronic
903096620 1:20982039-20982061 AGCTAAATTAAACCATCTGTAGG + Intronic
908237447 1:62160106-62160128 CAGGAGGTTTCACCATCTGTAGG - Intronic
912043952 1:105430129-105430151 CTGGAAGCAAAACCATTTGTGGG + Intergenic
912079864 1:105922053-105922075 CTGAAAGTTAAAATATCTGTTGG + Intergenic
912584519 1:110750258-110750280 CCGGAAGCTAAGCCATCTGTCGG - Intergenic
916490578 1:165298670-165298692 GGGGAAGTTACACCTTATGTGGG - Intronic
921208350 1:212869453-212869475 CAGGAAGTCAAACTATCTTTTGG - Intronic
921479445 1:215647257-215647279 GGGGAAGTTAAACGATCAATGGG - Intronic
1063179134 10:3581634-3581656 GGGGAACTAAAAACATCTGTTGG - Intergenic
1072832096 10:98669753-98669775 TGGGATGAAAAACCATCTGTTGG + Intronic
1074973943 10:118565634-118565656 CGGTACCTTAAACCTTCTGTGGG + Intergenic
1081398823 11:42618607-42618629 AGGGAATTTAGACCATTTGTAGG - Intergenic
1082568078 11:54704811-54704833 CTGGAAGTGAAACCTCCTGTCGG - Intergenic
1086375138 11:86192457-86192479 CAGGATGTGAAACCATCTTTGGG + Intergenic
1092284218 12:7119493-7119515 CAGGCAGGTAAACCATCTGGGGG - Intergenic
1094381173 12:29844784-29844806 GGGGCAGGTAAAGCATCTGTAGG + Intergenic
1121744890 14:96280303-96280325 CTGGAAGTCAAACCATGTGACGG + Intergenic
1124802036 15:32842333-32842355 CTGGAATTGAAATCATCTGTAGG - Intronic
1131406610 15:92170057-92170079 CTGGAAGTTTAACTTTCTGTAGG + Intronic
1158418454 18:57271288-57271310 CTACAAGTTAAACCATCTGTAGG + Intergenic
1165358004 19:35315805-35315827 TGGGAAGGGAAACCCTCTGTGGG + Intergenic
926005499 2:9370551-9370573 AGAGAAGTTAAACAATCTGCCGG - Intronic
932308569 2:70721489-70721511 GGGGAAGATAAATGATCTGTAGG - Intronic
932915281 2:75851383-75851405 TGGGAAGTTTACCCAACTGTGGG - Intergenic
937776489 2:125783001-125783023 CTGGAAGCCAAACCCTCTGTAGG - Intergenic
952187823 3:30989476-30989498 GGGGCAGCTAATCCATCTGTTGG - Intergenic
955538131 3:59946463-59946485 CGGGAAGTTAAACCATCTGTTGG - Intronic
968922993 4:3532223-3532245 GGAGAAGTTGAACCAGCTGTGGG - Exonic
979565568 4:122151095-122151117 GGGGAACTTGAACCATCTCTAGG + Intergenic
982207603 4:153008675-153008697 TGGGTAATTCAACCATCTGTAGG - Intergenic
996195151 5:120596322-120596344 GGTGAAGTTAAAACATCTGAAGG + Intronic
996556465 5:124783828-124783850 CGCAAAGTTAAACTATATGTTGG + Intergenic
1005496749 6:26394265-26394287 CTGGAAGTTAATCCATGTGCTGG + Exonic
1006342620 6:33454826-33454848 CTGGAAGTTAAAACCCCTGTTGG + Intronic
1007536181 6:42591616-42591638 AGGGAAATTAAACCTTCTATAGG - Intronic
1008766232 6:54918858-54918880 CGGGGAGTTACACCATTTGAGGG - Intronic
1010686767 6:78862208-78862230 TGGGAGGTTAAAATATCTGTGGG + Intergenic
1011702621 6:89969737-89969759 CAGGAAGAGAAACGATCTGTTGG + Intronic
1040909421 8:52502917-52502939 AAGGAAGGTAAACCACCTGTGGG - Intergenic
1041981842 8:63871144-63871166 GGGGAAGTAAGCCCATCTGTTGG - Intergenic
1049048516 8:140172367-140172389 GGGGGAGTTAAACTACCTGTGGG + Intronic
1061707485 9:132463951-132463973 CGGGAACTAAAACCATCAGGCGG - Intronic