ID: 955538623

View in Genome Browser
Species Human (GRCh38)
Location 3:59951231-59951253
Sequence GGACCACCATGAACCCACCT GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 99
Summary {0: 1, 1: 0, 2: 0, 3: 2, 4: 96}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
955538615_955538623 18 Left 955538615 3:59951190-59951212 CCGTATTATCCTGGAAGAGCTAA 0: 1
1: 0
2: 0
3: 9
4: 131
Right 955538623 3:59951231-59951253 GGACCACCATGAACCCACCTGGG 0: 1
1: 0
2: 0
3: 2
4: 96
955538614_955538623 19 Left 955538614 3:59951189-59951211 CCCGTATTATCCTGGAAGAGCTA 0: 1
1: 0
2: 0
3: 11
4: 98
Right 955538623 3:59951231-59951253 GGACCACCATGAACCCACCTGGG 0: 1
1: 0
2: 0
3: 2
4: 96
955538616_955538623 9 Left 955538616 3:59951199-59951221 CCTGGAAGAGCTAATGTGTGTTC 0: 1
1: 0
2: 0
3: 11
4: 101
Right 955538623 3:59951231-59951253 GGACCACCATGAACCCACCTGGG 0: 1
1: 0
2: 0
3: 2
4: 96
955538613_955538623 20 Left 955538613 3:59951188-59951210 CCCCGTATTATCCTGGAAGAGCT 0: 1
1: 0
2: 0
3: 3
4: 72
Right 955538623 3:59951231-59951253 GGACCACCATGAACCCACCTGGG 0: 1
1: 0
2: 0
3: 2
4: 96

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
955538623 Original CRISPR GGACCACCATGAACCCACCT GGG Intronic
901724331 1:11228835-11228857 GGGCCACCATGGACACAGCTGGG + Exonic
904400579 1:30254019-30254041 AGCCCAGCATGAACCCAGCTTGG + Intergenic
908020468 1:59892976-59892998 TGACCACAATTAACCAACCTGGG - Intergenic
913509639 1:119550012-119550034 GGAACACCATGCACCGGCCTGGG - Intergenic
922490635 1:226013779-226013801 GTACCACCATCTATCCACCTGGG + Intergenic
1063616037 10:7601310-7601332 TGACCTCCAAGAACCCCCCTGGG - Intronic
1067575389 10:47405280-47405302 GGCCCAGCATGAACCCTCCATGG - Intergenic
1070458930 10:76645343-76645365 GGACCATCATTAAACCACCCTGG + Intergenic
1075083166 10:119397254-119397276 GGGCCACCCCGACCCCACCTCGG + Intronic
1082091932 11:48097279-48097301 GGACCAGCATGAACCAAGGTAGG + Intronic
1083987932 11:66229042-66229064 GGCCCACCATGACCCAGCCTGGG - Intronic
1085460765 11:76691945-76691967 GAGCCACCATGCACCCAGCTGGG - Intergenic
1089604242 11:119632472-119632494 GGTCCAGCATGGACCCAGCTGGG - Intronic
1092850027 12:12618385-12618407 GCCCCACCATGACCCCATCTGGG - Intronic
1093652057 12:21657450-21657472 TGGCCGCCATGAACCCACCAAGG + Exonic
1098996803 12:77129897-77129919 GGACCGCCAGTAACTCACCTGGG + Intergenic
1102503522 12:113369217-113369239 GGAGCCCCATGTCCCCACCTTGG - Intronic
1104518643 12:129452290-129452312 GGACCACTATGAACGTACTTGGG + Intronic
1105889807 13:24674509-24674531 GGGCCACCATGCACCTACCCTGG + Intergenic
1107030990 13:35853696-35853718 GCACCATCATGAAACCTCCTAGG + Intronic
1111919592 13:94396311-94396333 GAACCCCCATGCACCCATCTGGG - Intronic
1113806886 13:113115209-113115231 GTACCACCGTGAGCCCGCCTGGG - Intronic
1113811750 13:113146907-113146929 GGACCCCCAGGAAGTCACCTGGG + Intronic
1113887002 13:113666280-113666302 GGAACACCTGGAACACACCTGGG - Intergenic
1119298491 14:73552462-73552484 GTACCATCATAAACCCACCCTGG + Intronic
1119302788 14:73584649-73584671 GTACCATCATAAACCCACCCTGG + Intergenic
1123702407 15:22925085-22925107 CCACCTCCATGAACCAACCTTGG - Intronic
1129232964 15:74206837-74206859 TGACCAGCATGAACCCACGTGGG + Intronic
1129691078 15:77713948-77713970 GGACCACCAGGAAGCGACGTGGG - Intronic
1130082857 15:80749688-80749710 GGACAAGCATGAACTTACCTGGG - Exonic
1131084568 15:89565504-89565526 GGACCACCAGAATCCCACGTAGG - Intergenic
1132436255 15:101806117-101806139 TGACCATCATGAACCCACAAAGG + Exonic
1132948071 16:2543574-2543596 GGAACATCCTGGACCCACCTGGG - Intronic
1132966376 16:2657768-2657790 GGAACATCCTGGACCCACCTGGG + Intergenic
1133910459 16:10061281-10061303 AGGACACCATGAAGCCACCTTGG + Intronic
1135247671 16:20870959-20870981 GGAGCCCCTTGATCCCACCTGGG + Intronic
1135589648 16:23695781-23695803 GGATCAACCTGTACCCACCTCGG + Intronic
1142995472 17:3757458-3757480 GGTCCTCCAGGAACCCTCCTTGG + Intronic
1147924568 17:43938641-43938663 GGACCACCACGAACCCCCAGTGG + Exonic
1152914015 17:83023373-83023395 GCACCAGCATGAACTCACATTGG + Intronic
1153109003 18:1561219-1561241 GGGTCACCATGTACACACCTGGG + Intergenic
1157103665 18:44753234-44753256 GGACCAATTTGAACCCACCATGG + Intronic
1158218554 18:55126312-55126334 GGATCACCTGTAACCCACCTCGG - Intergenic
1160608592 18:80071119-80071141 GTAGCACCATGCACCCTCCTGGG - Intronic
1162428387 19:10611532-10611554 GAACCACGATCCACCCACCTTGG - Intronic
1165831201 19:38731252-38731274 GGCCCACAGGGAACCCACCTTGG + Exonic
1166539249 19:43594739-43594761 GGACCTCCATGGTCGCACCTAGG + Intronic
928112631 2:28522871-28522893 GGGCCATCATGAACTTACCTGGG + Intronic
928454074 2:31403530-31403552 GGCACACCATGAAGCCACTTGGG + Intronic
929589585 2:43136203-43136225 GGACCCCCACGAGCCCACCCTGG + Intergenic
929778123 2:44941119-44941141 GGCCCACCAAGCACCGACCTTGG - Intergenic
935596671 2:104883988-104884010 GGACCACTGGGAACTCACCTAGG - Intergenic
938102175 2:128504665-128504687 TGACCACCATCAGCCAACCTTGG - Intergenic
943447933 2:188012681-188012703 GAAACACCATGAACTCACCCAGG + Intergenic
946048463 2:216841065-216841087 GGAACACCATGGACACACTTTGG + Intergenic
946413070 2:219525195-219525217 AGACCAGCATGAACCAAGCTAGG - Intronic
947899856 2:233712210-233712232 GGAGCTCCCTGAACCCACCATGG + Intronic
947900557 2:233718040-233718062 GGAGCTCCCTGAACCCACCGTGG + Intronic
947901949 2:233728350-233728372 GGAGCTCCCTGAACCCACCATGG + Intronic
948942875 2:241204754-241204776 GGACCACCCTCAGCCCAGCTTGG - Intronic
1171449638 20:25226527-25226549 GGGCCACCATCCGCCCACCTCGG + Exonic
1173920428 20:46740649-46740671 TGACCACCATATACCCACCCTGG - Intergenic
1176873272 21:14101206-14101228 GCACCACCATGCTCCAACCTGGG - Intergenic
1179788340 21:43741820-43741842 GGACCTCCCTGAGCCCACCCTGG - Intronic
1183063781 22:35350246-35350268 GGGCCACCACGATCCCACCCTGG + Intergenic
949876309 3:8628167-8628189 AGCCCACCATGAGCCCAACTGGG - Intronic
950697643 3:14715565-14715587 GGACCACCATCCACCAACTTGGG - Intronic
954311506 3:49772133-49772155 CTGCCACCTTGAACCCACCTTGG - Intronic
955538623 3:59951231-59951253 GGACCACCATGAACCCACCTGGG + Intronic
963046794 3:141108494-141108516 AGACCACCAGGGAGCCACCTGGG + Intronic
964406191 3:156351864-156351886 GGCCCACCCTAAACTCACCTTGG - Intronic
967197118 3:187038131-187038153 CGGCCACCATGGACCAACCTGGG - Intronic
968620669 4:1602084-1602106 GCACCACCATGAACCAGCCCTGG - Intergenic
974385425 4:61198858-61198880 GGACATCCATGAACTCCCCTGGG - Intergenic
976391047 4:84503886-84503908 GGACCACCACGAACACACTGAGG - Intergenic
993575994 5:89601635-89601657 GTACCACCATGATGCCACGTGGG + Intergenic
994295825 5:98086629-98086651 AGGCCACCCTAAACCCACCTTGG + Intergenic
999806325 5:155084735-155084757 GGACCACCATTACTCCCCCTGGG - Intergenic
1001858594 5:175033757-175033779 GGATCACCTTGAATGCACCTTGG + Intergenic
1007324552 6:41049979-41050001 GGACCAGCCTGAGACCACCTGGG + Intronic
1018020435 6:159758357-159758379 GGACTACCAGGAACCAAACTGGG - Intronic
1018775593 6:167012058-167012080 CCACCACCATAAACCCACATGGG - Intronic
1019558814 7:1645773-1645795 GCCCCACCTTGAACACACCTGGG - Intergenic
1021438473 7:20649520-20649542 GGGTCACCATGAGCCCACCAAGG + Intronic
1022625791 7:32034553-32034575 GAGCTACCATGAACACACCTTGG - Intronic
1022950261 7:35331922-35331944 GGACCGCCCTGCCCCCACCTGGG - Intergenic
1026737778 7:72960020-72960042 GGACCACCATGAGTTCATCTGGG - Exonic
1026981014 7:74526585-74526607 GTGCCACCATGCACCCTCCTCGG - Intronic
1027105956 7:75405048-75405070 GGACCACCATGAGTTCATCTGGG + Exonic
1030235980 7:107262601-107262623 GCAACGCCAAGAACCCACCTTGG - Intronic
1034090332 7:148358116-148358138 CGACCACCTTGAACACCCCTAGG - Intronic
1037225108 8:16577840-16577862 GGAGCACAATGAACCTTCCTAGG + Intergenic
1042376904 8:68062089-68062111 GTACCACCATCCACCCAGCTAGG + Intronic
1050169426 9:2799958-2799980 AGACCACCATGAAGCCAGGTAGG + Intronic
1050355946 9:4782588-4782610 TGACAACAATGGACCCACCTGGG + Intergenic
1054761782 9:69011429-69011451 GAATCACCCTGAGCCCACCTGGG + Intergenic
1057046507 9:91890221-91890243 GGACCAGCAAGGACCCACCTTGG + Intronic
1060951426 9:127606297-127606319 GGAGCACCATGATGCAACCTTGG + Intergenic
1061273547 9:129557391-129557413 GGACCACCCTGTCCCCACCCTGG - Intergenic