ID: 955539543

View in Genome Browser
Species Human (GRCh38)
Location 3:59959941-59959963
Sequence ATGTAGAGGTTCATGGAGGA AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 531
Summary {0: 1, 1: 0, 2: 8, 3: 89, 4: 433}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
955539543 Original CRISPR ATGTAGAGGTTCATGGAGGA AGG Intronic
901385118 1:8903062-8903084 ACGTGGAGGTTCCTGGAGGGTGG + Intergenic
901853277 1:12029394-12029416 ATGTTGAGACTCATGGAGGGAGG + Intronic
902101342 1:13992457-13992479 AAGTAGTGAGTCATGGAGGAGGG + Intergenic
902285214 1:15403916-15403938 AGGTGGAGGTTCCTGGAGGGTGG - Intergenic
902339810 1:15775653-15775675 ATGTGGGGGTTCCTGGAGGGTGG - Intronic
903793178 1:25908163-25908185 ATCTGGAGGTTCACAGAGGAAGG + Intergenic
904730585 1:32587994-32588016 ATGTGGAGGTTCCTGGAGGGTGG + Intronic
904745199 1:32706428-32706450 ATATGGAGGTTCCTGGAGGATGG - Intergenic
906764917 1:48420192-48420214 ATGTGGAGGTTCCTGGAGGGTGG + Intronic
906867041 1:49433042-49433064 AAGTGGAGGTTCCTGGAGGGTGG + Intronic
906910410 1:49943252-49943274 ATGGAGAGGATCATGGCAGATGG + Intronic
907103262 1:51856626-51856648 ACGTGGAGGTTCTTGGAGGGTGG - Intronic
907798473 1:57740924-57740946 AAGGAGGGCTTCATGGAGGAGGG + Intronic
908293944 1:62694340-62694362 ATGTAGAGGTTTCTGGAGGGTGG - Intergenic
908400949 1:63772544-63772566 TTATAGGGGTGCATGGAGGAGGG - Intergenic
908560522 1:65301671-65301693 AAGTGGAGGTTCCTGGAGGATGG - Intronic
910011696 1:82471734-82471756 ATGTAGCGGTTCCTGGAGGGTGG - Intergenic
911890950 1:103371243-103371265 ATGAGGAGGTTCCTGGAGGGTGG + Intergenic
912553848 1:110501853-110501875 ATGAAGAGGTCCCTGGAGCAAGG + Intergenic
912618551 1:111132247-111132269 ATGCGGAGGTTCCTGAAGGATGG + Intronic
912837055 1:113005899-113005921 ATTTAGAGGCTCATTAAGGAAGG - Intergenic
913671881 1:121104854-121104876 ATGTAGAGGTTCCTGAAGGGTGG - Intergenic
914023656 1:143892299-143892321 ATGTAGAGGTTCCTGAAGGGTGG - Intergenic
914343030 1:146776427-146776449 ATGTGGAAGTGCATGGATGAAGG + Intergenic
914662131 1:149800244-149800266 ATGTAGAGGTTCCTGAAGGGCGG - Intronic
914731440 1:150374265-150374287 ATATGGAGGTTCCTGGAGGTTGG + Intronic
914967817 1:152277146-152277168 GTGTGGAGGATCATGGTGGATGG + Intergenic
915116437 1:153603599-153603621 AAGTAGAGGTGCAAGGAAGAAGG - Intergenic
916027924 1:160851087-160851109 ATGCGGAGGTTCCTGGAGGGTGG - Intronic
916211458 1:162363402-162363424 ATTTAGAGGTTCCTGGAGGGTGG - Intronic
917155323 1:171991542-171991564 ATGCAGAGGTTTCTAGAGGATGG - Intronic
917436319 1:175024526-175024548 ATGTGGAGGTTTCTGGAAGATGG - Intergenic
918075460 1:181167833-181167855 ACGTGGAGGTTCTTGGAGGGTGG + Intergenic
918141484 1:181723851-181723873 ATGTGGAGGTTCCTGGAGACTGG - Intronic
918190158 1:182165889-182165911 ATGTATAGGTTCTTGGGGGCTGG + Intergenic
918471383 1:184878902-184878924 ATTTAGAGTTTCATGGACCAGGG + Intronic
918568308 1:185956546-185956568 ACATAGAGGTTCCTGGAGGATGG - Intronic
918615245 1:186536816-186536838 ATGTGGAGGTTCCTGGAGGGTGG + Intergenic
918919870 1:190694515-190694537 ATGTGGAGGTTCCTAAAGGATGG - Intergenic
918990847 1:191695532-191695554 TTGTAGAGGTTCCTGGAGGGTGG + Intergenic
919830408 1:201536894-201536916 ATGGACAGGTTGAGGGAGGAAGG - Intergenic
920056034 1:203192468-203192490 ATGTGGAGGTTCCTGGAGAGCGG - Intergenic
920578208 1:207078843-207078865 ATGGGGAGGTTGAGGGAGGAGGG + Intronic
921195694 1:212755362-212755384 ATGGAGATGTTAATGGAAGATGG + Intronic
922072007 1:222204021-222204043 ATGTAGAGTCTCATGCAGGCTGG + Intergenic
922759934 1:228122210-228122232 ACGTGGAGGTTCATGGAGGGTGG - Intergenic
923214676 1:231837497-231837519 ATGTAATGCTTCATGGAAGAGGG - Intronic
923228425 1:231961062-231961084 ATGTGGAGGTTCCTTGAAGATGG - Intronic
924236095 1:242000719-242000741 ACGTGGAGGTTCCTGGAGGGTGG - Intergenic
1063173793 10:3533759-3533781 ATGAAGAGGATCAGGGAGGGAGG - Intergenic
1063173812 10:3533829-3533851 ATGAAGAGGATCAGGGAGGGCGG - Intergenic
1064655487 10:17551574-17551596 GTGTGGAGGTTCCTGGAGAATGG + Intergenic
1065053673 10:21820908-21820930 GTGTGGAGGTTCCTGGAGGGTGG - Intronic
1065289427 10:24215036-24215058 ACGCAGAGGCTCATGGAAGATGG - Intronic
1065768392 10:29053599-29053621 ATGTGGAGGTTCCTGGAGGGTGG - Intergenic
1066040350 10:31543116-31543138 ATGTAGAGCTTCTTGGAGGGTGG - Intergenic
1067228455 10:44390438-44390460 CAGTGGAGGTTCCTGGAGGATGG - Intergenic
1068035340 10:51752467-51752489 ATGGAGAGGGTCATGTAGGAAGG + Intronic
1069027647 10:63561315-63561337 ATTTAGAAGTTTATGGAGGAAGG + Intronic
1069481431 10:68785760-68785782 CTGAAGAGGTTCAGGGAAGATGG - Intronic
1069906099 10:71733282-71733304 ATGTAGGGGTGCCTGGAGGGTGG - Intronic
1070677598 10:78422981-78423003 AAGTGGAGGTTCATGAAGGGTGG - Intergenic
1070794919 10:79210861-79210883 ATGGAGGGCTTCCTGGAGGAGGG + Intronic
1071662511 10:87518878-87518900 ATGTGGAGCTTCCTGGAGGGTGG - Intronic
1071664870 10:87544327-87544349 ATGTGGAGGTTCCTGGAGGGCGG - Intronic
1072464176 10:95647876-95647898 ATGTGGAGGTTCCTGGAGGGTGG + Intronic
1073640634 10:105249317-105249339 AAGCAGAGGTTCATGCTGGAGGG + Intronic
1074153519 10:110779349-110779371 ATGTGGAGGTTCCTGGAGAGGGG + Intronic
1077347884 11:2072720-2072742 ATGCAGAGCTGCATGGAGAAAGG - Intergenic
1079017084 11:16878359-16878381 TCGTAGAGTTTAATGGAGGAGGG - Intronic
1079087715 11:17458820-17458842 ATGAACAGCTTCATAGAGGAGGG - Intronic
1079377703 11:19908374-19908396 AGGAAGAGGTTAACGGAGGAAGG - Intronic
1079835292 11:25326554-25326576 ATGTGGAGGTTCCTGGAGGGTGG + Intergenic
1079876906 11:25869988-25870010 ATGTAGAAGTTGATGGAAGATGG + Intergenic
1080258005 11:30314043-30314065 CTGGAGTGGTTCCTGGAGGAGGG - Intergenic
1080310992 11:30891943-30891965 TTGGAGAAGTTCATGGAGGCTGG - Intronic
1081865865 11:46360422-46360444 ACATGGAGGTTCCTGGAGGATGG + Intronic
1083168178 11:60904725-60904747 ATGTGGGGGTTCCTGGAGGGTGG - Intronic
1083869218 11:65476947-65476969 ATGTAGGGGTTCAAGGAGCTAGG + Intergenic
1085235567 11:75012307-75012329 ATGCATAGGTTCATTGAGGAAGG - Intronic
1085624419 11:78061130-78061152 ATGTCGAGGCTCAGGGAGGCTGG + Intronic
1087336828 11:96854110-96854132 AGGTAGAGGGCCAGGGAGGAAGG + Intergenic
1088205066 11:107382980-107383002 ACGTAGAGGTTCCTGGAGGGTGG + Intronic
1088473903 11:110215540-110215562 ATGCAGTGGTTCAAGGAGGTTGG + Intronic
1089047782 11:115518455-115518477 ATGTGGAGGTTCCTGGAGGGTGG + Intergenic
1090325149 11:125879593-125879615 ATATAGAGGTTCCTTGAGGGTGG - Intergenic
1090417576 11:126551166-126551188 ATGTAAAGCTTCCTGGAGGGTGG - Intronic
1090556142 11:127878558-127878580 TTCTAGAGGTTCCTGGAGGGTGG - Intergenic
1091961406 12:4698168-4698190 ATGTGGAGGTTCCTGGAGGGCGG - Intronic
1092525967 12:9310596-9310618 ATCTAGATGCTTATGGAGGAAGG + Intergenic
1092541324 12:9421211-9421233 ATCTAGATGCTTATGGAGGAAGG - Intergenic
1093254538 12:16850607-16850629 AAGTGGAGGTTCCTGGAGGGTGG - Intergenic
1093467282 12:19462695-19462717 ATGTAGATGGTCAGCGAGGAGGG + Exonic
1093518141 12:20015614-20015636 TTGAAGAGGATCATGGAGGCAGG + Intergenic
1093657630 12:21715092-21715114 ATGTAGAGTTTCATGGCAGTGGG + Intronic
1094196146 12:27751905-27751927 ATGAAAAGGTACATGGAGGTAGG - Intronic
1094511724 12:31101284-31101306 ATCTAGATGCTTATGGAGGAAGG + Intronic
1094765920 12:33594582-33594604 ATGAGGAGGTTTATGGAGGGTGG + Intergenic
1095278149 12:40315454-40315476 TTGAAGAGCTTCATGGAAGAAGG + Intronic
1095519192 12:43041617-43041639 GTGTGGAGGTTCCTGGAGGGTGG - Intergenic
1095730932 12:45506139-45506161 ATGTAGATGTTCCTGGAGGGTGG + Intergenic
1096140503 12:49238874-49238896 ACGTAGAGGTTCCTGGAGAGTGG - Intronic
1097039989 12:56150256-56150278 ATGTGGAGGTTCCTGGAGGACGG + Intergenic
1097798144 12:63885405-63885427 ATGTAGAGGTTCCTGGAGCGTGG - Intronic
1097932923 12:65210116-65210138 ATTTAGAGGTGAATGAAGGAGGG + Intronic
1098021331 12:66159332-66159354 ATGGAGAGGTTCATGTGGCAAGG + Intronic
1098825173 12:75287618-75287640 TTGTGGAGGTTCCTGGAGGGTGG + Intronic
1099849545 12:88074824-88074846 ATGTGGAGGTTTCTAGAGGAAGG + Intronic
1100163131 12:91884617-91884639 ATGCAGAGGTTCATCGTTGAGGG - Intergenic
1100657340 12:96661015-96661037 ATGTGGAGGTTCCCGGAGGCTGG - Intronic
1101114364 12:101517844-101517866 ATGTGGAGGTTCCTGCAGGGTGG - Intergenic
1101582161 12:106051080-106051102 ATGTGGAAGTTCCTGGAGGGTGG - Intergenic
1105267324 13:18832897-18832919 AGGTGGAGGGACATGGAGGAAGG + Intergenic
1105286607 13:19009303-19009325 ATGTAGAGGCTCATGCAGGCTGG - Intergenic
1106081819 13:26506634-26506656 ATGAAGAGTTTCAAGGGGGAGGG - Intergenic
1106838207 13:33658975-33658997 ATGTGGAGGTTCCTGGAGGGTGG + Intergenic
1107149982 13:37099763-37099785 ATGTGGAGGCTCCTGGAGGGTGG - Intergenic
1107530414 13:41277609-41277631 ATGTGGAGGTTTCTGGAGGGTGG - Intergenic
1110488402 13:76073110-76073132 ATGTAGAATTTCCTGGAGGGTGG + Intergenic
1110620172 13:77586010-77586032 ATGGAGAGTTTCAGGGAGGAGGG - Intronic
1112452764 13:99526892-99526914 AGCTAGAGGTTTCTGGAGGAGGG + Intronic
1113036681 13:106057441-106057463 ATAGAGGGGGTCATGGAGGATGG + Intergenic
1114930819 14:27465857-27465879 AAGAAAAGGTTCATTGAGGAAGG + Intergenic
1115500075 14:34041813-34041835 ATGTAGAGGCATATGGAGCATGG + Intronic
1115511074 14:34138413-34138435 ATGTTGAGGTTCTTTGAAGATGG - Intronic
1115826989 14:37289632-37289654 ATGTGGAGGTTCCTGGAGGGTGG - Intronic
1115984053 14:39085196-39085218 ATGTGGAGGTTCCTGGAGGGTGG + Intronic
1116396275 14:44451534-44451556 ATATGGAGGTTTCTGGAGGAGGG + Intergenic
1116590799 14:46769851-46769873 CTGTAGAGGTTGGTGGGGGAAGG - Intergenic
1116795291 14:49383669-49383691 ATGTAGGGGTTCATAAAGGAAGG + Intergenic
1116965941 14:51015412-51015434 ATGGAGAGGTAAATGGAGGTGGG - Intronic
1117190804 14:53289243-53289265 ATGAGGAGGTTCCTGGAGGGCGG + Intergenic
1117229444 14:53700680-53700702 ATGTCGAGGCTCCTGGAGGGTGG + Intergenic
1117353961 14:54905877-54905899 ATGTGGAGGTTCCTGGAGGGTGG + Intergenic
1117719506 14:58615494-58615516 ATGTCCAGGTTGATGGAGGGAGG + Intergenic
1119068575 14:71556693-71556715 ATGTAGAAGTTCTTGGAAGGTGG - Intronic
1119922604 14:78460197-78460219 ATGTCGAGGTTCCTGGAGGGTGG - Intronic
1123058823 14:105585307-105585329 ATGGAGGGGTGAATGGAGGATGG - Intergenic
1123083150 14:105705533-105705555 ATGGAGGGGTGAATGGAGGATGG - Intergenic
1123171796 14:106379619-106379641 ACCTAGAGGTTCCTGGAGGAAGG + Intergenic
1202831448 14_GL000009v2_random:38577-38599 AGGTGGAGGGACATGGAGGAAGG - Intergenic
1124222328 15:27861513-27861535 ATGGAGAGGGTCATGGAAGGAGG + Intronic
1124693745 15:31846325-31846347 GGGTAGAGGTTTGTGGAGGAAGG + Intronic
1125439735 15:39689245-39689267 ATGTAGAGGTGCTGGGAGGGTGG - Intronic
1126312523 15:47334159-47334181 ATGTGGAGGTTCCTGGAGGGTGG + Intronic
1126763717 15:51992886-51992908 ACGTGGAGGTTCCTGGAGGGAGG - Intronic
1127055956 15:55131684-55131706 ATGTGGAGGTTCCTGGAGAGTGG + Intergenic
1127534627 15:59878715-59878737 ATTTAGAGCTTAAAGGAGGATGG + Intergenic
1127619199 15:60716808-60716830 ATGTGGAGGTTCCTGGAGAATGG + Intronic
1127897421 15:63314424-63314446 GTGTGGAGGTTCTTGGAGGGTGG - Intergenic
1127905960 15:63376194-63376216 ATGCAGAGGCTCATGGAAGCAGG + Intronic
1128825354 15:70710798-70710820 ATGTGGAGGCACCTGGAGGATGG - Intronic
1128856237 15:71019052-71019074 ATGTGGAGGTTCCTGAAGGGTGG - Intronic
1129067759 15:72921856-72921878 ACGTGGAGGTTCCTGGAGGGTGG - Intergenic
1129699644 15:77760246-77760268 ATGGAGAGGCTCAAGGAGGTGGG + Intronic
1129778685 15:78254485-78254507 ATGTGGAGGTTCCTGGAGGGTGG + Intergenic
1129912371 15:79239437-79239459 ATGCACAGGGTCAGGGAGGAAGG - Intergenic
1130074189 15:80674565-80674587 ATGTGGAGGTTCCTGGAGGGTGG + Intergenic
1131878688 15:96838960-96838982 ATGTGGAGGTTCCTGGATGGTGG + Intergenic
1131983963 15:98022957-98022979 ACGTGGAGGTTCTTGAAGGATGG - Intergenic
1132327314 15:100982510-100982532 ATGTAAAGGTCCCAGGAGGAGGG - Intronic
1134238524 16:12486626-12486648 CTGTAGAGGATCCTGGAGGCTGG + Intronic
1134356121 16:13483783-13483805 ATGTAGAGGTTTCTGAAGGGTGG + Intergenic
1135121713 16:19771863-19771885 AGGCAGAGGTTTATGGAGGAGGG + Intronic
1136932190 16:34429037-34429059 ATGGAGGGGATCATGGCGGATGG + Intergenic
1136972382 16:34982777-34982799 ATGGAGGGGATCATGGCGGATGG - Intergenic
1137281278 16:46978847-46978869 ATGTGGAGGTTCCTGGAGGGTGG + Intergenic
1137579891 16:49627374-49627396 ATGGATAGGTAGATGGAGGATGG - Intronic
1137580028 16:49627985-49628007 ATGGATAGGTAGATGGAGGATGG - Intronic
1139827699 16:69770425-69770447 ACGTGGAGGTTCTTGGAGGATGG + Intronic
1139990956 16:70938901-70938923 ATGTGGAAGTGCATGGATGAAGG - Intronic
1140530563 16:75662253-75662275 ATGTGGAAGTTCCTGGAGGGTGG - Intronic
1143240575 17:5439774-5439796 ACGTAGAGGTTCCTGGAGGGTGG + Intronic
1143855322 17:9843977-9843999 ATGCCCAGGGTCATGGAGGATGG + Intronic
1144569147 17:16384823-16384845 GTATGGAGGTTCCTGGAGGATGG + Intergenic
1145086237 17:19943493-19943515 CTGTAGAGGTTCTTGGAGGGTGG + Intronic
1145360390 17:22207264-22207286 ACATGGAGGTTCCTGGAGGATGG + Intergenic
1145834324 17:27942659-27942681 ATGCAGATGTCCATGGAGTAAGG + Intergenic
1146663327 17:34679831-34679853 ATGAAGAGGTTCATAGGGTAAGG - Intergenic
1147587992 17:41663909-41663931 ATGCAGAGGTTGATGGAGAGAGG + Intergenic
1147742059 17:42675385-42675407 AGGTGGAGGTTCACGTAGGAAGG - Intronic
1149548620 17:57523021-57523043 ATGCAAAGGTACATGGAGGGAGG - Intronic
1149698731 17:58637594-58637616 ATGGAGAGGTTCCTGGAGGATGG + Intronic
1150360434 17:64528392-64528414 AGGAAGAGGTTCCTGGATGAGGG - Intronic
1150508790 17:65726412-65726434 CAGCAGAGCTTCATGGAGGAGGG + Intronic
1151505214 17:74522889-74522911 ATGTAGTGGTTCCTGGGGAAGGG + Exonic
1151696844 17:75722198-75722220 CTGTAGAGCTTCCTGAAGGAAGG - Intronic
1151947350 17:77326919-77326941 ATGTGGAGGCTCCTGGAGGGTGG + Intronic
1152332140 17:79679453-79679475 ATGGAGGGGTTCAAGGTGGAGGG - Intergenic
1153915171 18:9738540-9738562 ATGTGGAGGCTCCTGGAGGGCGG + Intronic
1154084562 18:11290391-11290413 ATGTAGAGGTTCCTGGAAGGTGG - Intergenic
1154126678 18:11698141-11698163 AGGAAGAGGTTTCTGGAGGAAGG + Intronic
1154334894 18:13457363-13457385 ATGCAGAGGCTCTTGGAGGGGGG - Intronic
1154421089 18:14228533-14228555 AGGTGGAGGGACATGGAGGAAGG - Intergenic
1155042191 18:22074097-22074119 AAATAGAGGTTCCTGGAAGATGG - Intergenic
1157514270 18:48299696-48299718 ATGAAGAGGCTGAAGGAGGATGG + Intronic
1158055276 18:53271579-53271601 ATGGAGAGGTCCATGGAGCAAGG - Intronic
1158889824 18:61862595-61862617 ATGCTGAGGTTCCTGGAGGGTGG + Intronic
1159017639 18:63114714-63114736 ATGCTGAGGTTCCTGGAGGGTGG + Intergenic
1159404231 18:67978500-67978522 ATTTTGAGGTTCATGCAGAAAGG + Intergenic
1161003510 19:1923222-1923244 GTGACGAGGTTCATGGAGAAGGG - Intronic
1161093341 19:2374688-2374710 TGGAAGAGGTTCTTGGAGGAAGG + Intergenic
1162581998 19:11537062-11537084 TAGTTGAGGTTCATGGAGCATGG + Intergenic
1163265600 19:16218810-16218832 ACGTGGAGGTTCCTGGAGGGTGG - Intronic
1163512141 19:17741645-17741667 ATGGAGGGCTTCCTGGAGGAAGG + Intergenic
1163512159 19:17741710-17741732 ATGGAGGGCTTCCTGGAGGAGGG + Intergenic
1164451173 19:28366356-28366378 ATGTGGAGGCTGATGAAGGAGGG + Intergenic
1164519021 19:28963319-28963341 ATGTGGAGGTTCCTGGAGGGCGG + Intergenic
1165508004 19:36246958-36246980 ACGTAAAGGTTCCTGGAGGGTGG - Intergenic
1166145328 19:40830620-40830642 ATGTAGAGGTGAAGGGAGCATGG - Intronic
1166370057 19:42295400-42295422 ATGTACAGGGGCTTGGAGGAGGG - Exonic
1166760080 19:45218601-45218623 ATGGAGGGCTTCCTGGAGGAGGG + Intronic
1166959437 19:46488860-46488882 ATGAAGAGGTCCCTGGAGTAGGG - Intronic
1167969562 19:53179534-53179556 ATGTGGAGGTTCCTGGAGGACGG + Intronic
1202641249 1_KI270706v1_random:89163-89185 AGGTGGAGGGACATGGAGGAAGG + Intergenic
926484620 2:13439155-13439177 ATGAAGTGGTTAATGGAGCATGG - Intergenic
928619278 2:33072281-33072303 ATGTGGAGGTGCCTGGAGGGTGG - Intronic
928924452 2:36563809-36563831 AGGAAGCGGTTCAGGGAGGAGGG - Intronic
929260282 2:39859402-39859424 ATGTGGAGGTTCCTGGAGGGTGG - Intergenic
932014604 2:68011626-68011648 ACGTGGAGGTTCCTGGAGGGTGG - Intergenic
932058825 2:68474174-68474196 ATGTAGAGGTTTCTGGAGGGTGG - Intronic
932177187 2:69613681-69613703 ATGTGGAGGTACCTGGAGGGTGG + Intronic
932632267 2:73355124-73355146 AAGTGGAGGTTCCTGGAGGGTGG - Intergenic
932723440 2:74157294-74157316 ACGTGGAGGTTCCTGGAGCATGG + Intronic
933422130 2:82062095-82062117 ATGTGGAGGTTCCTGGAGGGTGG - Intergenic
933484544 2:82902253-82902275 ATGTAGTGCTTCATGGAAGTAGG - Intergenic
933987900 2:87608015-87608037 ATGTGGAGGTTCCTGGAGAGTGG + Intergenic
934106013 2:88695054-88695076 ATGTGAAGGTCCCTGGAGGATGG + Intronic
934497061 2:94812593-94812615 AGGTGGAGGGACATGGAGGAAGG + Intergenic
936175335 2:110214800-110214822 ATGTGGAAGTTCCTGGAGGATGG - Intergenic
936305940 2:111342793-111342815 ATGTGGAGGTTCCTGGAGCGTGG - Intergenic
936380040 2:111976196-111976218 ATGTGCAGGTTCCTGGAGGGTGG - Intronic
936990921 2:118365182-118365204 ATGTAGAAGTTAATGAAAGAAGG - Intergenic
937254734 2:120547169-120547191 ATGTAGTGGTTCTTAGAGTAAGG - Intergenic
938400236 2:130985133-130985155 ATGTAGAGGTGCTTCTAGGAAGG + Intronic
939162931 2:138610555-138610577 ACATGGAGGTTCCTGGAGGATGG + Intergenic
939719799 2:145634600-145634622 ATGTAGAGGTTCCTGGAGGGTGG - Intergenic
941790480 2:169547267-169547289 ACGTGGAGGTTCCTGGAGGGTGG - Intronic
942572673 2:177329631-177329653 ATGTAGAGGTCCCTGGAGGGTGG - Intronic
943471942 2:188305266-188305288 ATGTAGAGGTTCTTGGAGGGTGG - Intronic
943666568 2:190615488-190615510 ATGTGGAGGTGCAGGGAGGCCGG - Intergenic
943937287 2:193935605-193935627 ATTCAGAGGATCATGGCGGATGG - Intergenic
945785158 2:214225202-214225224 ATGTAGAGATGCGTGGAGCAAGG + Intronic
945850646 2:215002657-215002679 ATGTAGATGTTGGTGGGGGAGGG + Intronic
946642435 2:221799193-221799215 ATGTACACTTTCAGGGAGGAGGG - Intergenic
946843689 2:223840639-223840661 ATGTAGAGGTTGAGGGGGGCAGG + Intergenic
947451067 2:230209475-230209497 AAGGAGAGGATCAGGGAGGAAGG + Intronic
948514737 2:238497010-238497032 ATTTAGGGGGTGATGGAGGATGG + Intergenic
1169004706 20:2196892-2196914 ATGGAGAAGGGCATGGAGGAGGG + Intergenic
1169451198 20:5713039-5713061 ATCTAGAGGATAATGGAAGAAGG - Intergenic
1169952140 20:11056639-11056661 ATTTTGAGGTTAATGGAGAAAGG + Intergenic
1170244725 20:14207882-14207904 ATGTAGTGAGTCCTGGAGGAAGG + Intronic
1170254363 20:14323411-14323433 ATGTGGTGGTTCCTGCAGGATGG - Exonic
1170586556 20:17739192-17739214 ATGTCCAGGATCATGTAGGAGGG + Intergenic
1171209047 20:23302904-23302926 ATGGAGAGGTTGAAGGAGAAGGG + Intergenic
1171213533 20:23335168-23335190 ATGTAGGGGTTCGTTGGGGAGGG - Intergenic
1171421603 20:25021297-25021319 GTGGAGAGGTTCATGGAAGGGGG - Intronic
1171520015 20:25768653-25768675 TTTTAGAGGTTTAAGGAGGAAGG - Intronic
1171556904 20:26087840-26087862 TTTTAGAGGTTTAAGGAGGAAGG + Intergenic
1171888356 20:30679374-30679396 AGGTGGAGGGACATGGAGGAAGG + Intergenic
1172215148 20:33230442-33230464 ATTTTAAGGTTCATGGAGCATGG + Intergenic
1172511118 20:35501757-35501779 ATATAGAGGCAGATGGAGGATGG - Intronic
1172913132 20:38424946-38424968 ATGTGGAGGTTACTGGGGGAAGG + Intergenic
1173894305 20:46538657-46538679 ACATAGGGGTTCCTGGAGGATGG + Intergenic
1174384876 20:50181512-50181534 ATGCAGAGGCTCATGCTGGAAGG - Intergenic
1175096352 20:56544394-56544416 ATCTGGAGGTTCATGGAAGGTGG + Intergenic
1175220254 20:57412558-57412580 AAGGTGAGGTTCAAGGAGGATGG - Intergenic
1175223523 20:57431801-57431823 ATGTTGAGGTCCAGGGAGGAGGG + Intergenic
1175382676 20:58574641-58574663 ATGGAGAGATAGATGGAGGAAGG - Intergenic
1176349381 21:5779780-5779802 TTGCAGAGGATGATGGAGGAAGG - Intergenic
1176356195 21:5900364-5900386 TTGCAGAGGATGATGGAGGAAGG - Intergenic
1176543702 21:8177850-8177872 TTGCAGAGGATGATGGAGGAAGG - Intergenic
1176562653 21:8360895-8360917 TTGCAGAGGATGATGGAGGAAGG - Intergenic
1176610635 21:8883408-8883430 AGGTGGAGGGACATGGAGGAAGG - Intergenic
1176654148 21:9574940-9574962 TTTTAGAGGTTTAAGGAGGAAGG - Intergenic
1176887806 21:14276756-14276778 AAGTAGATGCTCATGGAGAAGGG - Intergenic
1177911121 21:27033644-27033666 ATGGAGAGGTACATGCAGCAAGG + Intergenic
1178000648 21:28158741-28158763 ATGTGGAGGTTCCTAGAGGGTGG - Intergenic
1178660456 21:34503377-34503399 ATGTGGAGCTTCCTGGAGGGTGG - Intergenic
1178858048 21:36266575-36266597 ATGTGGAGGTTCCTAGAGGGTGG - Intronic
1180242959 21:46524103-46524125 ATGTACAGGATCATGGAACATGG - Intronic
1180360712 22:11892712-11892734 AGGTGGAGGGACATGGAGGAAGG - Intergenic
1180610319 22:17092200-17092222 ATGTGGAGGTTCCTGGAGGGTGG + Intronic
1180877888 22:19183535-19183557 CTGCAGTGGTTCCTGGAGGAAGG - Exonic
1181110551 22:20600384-20600406 ATGTGGAGGTGCAGGGAGCAGGG + Intergenic
1181421503 22:22802494-22802516 ATCTAGTGATACATGGAGGATGG + Intronic
1181425385 22:22834273-22834295 AACTAGTGGTACATGGAGGATGG + Intronic
1181863686 22:25839284-25839306 ATATATATTTTCATGGAGGAAGG + Intronic
1182028513 22:27138772-27138794 TTGCAGAGGTTCAAGGTGGAGGG + Intergenic
1183680926 22:39328723-39328745 ATGCACAGGCTCATGGAGGCTGG - Intergenic
1184376584 22:44117328-44117350 CTGTAGAGGGTGAAGGAGGAGGG + Intronic
1184480909 22:44746341-44746363 ATGGAGAATTTCAAGGAGGAGGG - Intronic
1203248570 22_KI270733v1_random:94072-94094 TTGCAGAGGATGATGGAGGAAGG - Intergenic
950071308 3:10155021-10155043 GTGTAGAGGTTCCTGGAGGGTGG + Intergenic
951415829 3:22420266-22420288 CTGTGGAGGTTCCTGGAGGGTGG + Intergenic
953282112 3:41569105-41569127 ATGTACAGGTTGCTGGAGGGTGG - Intronic
953580958 3:44156210-44156232 AAGTAGAGGTCAATGGAAGAGGG - Intergenic
955299603 3:57764560-57764582 ATGTAGAGTTGCCTGGAGCAAGG + Intronic
955539543 3:59959941-59959963 ATGTAGAGGTTCATGGAGGAAGG + Intronic
956491714 3:69779464-69779486 ATTTACAGGATAATGGAGGATGG + Intronic
956517018 3:70060874-70060896 CTGTAGAGGGTCATGGATGTAGG + Intergenic
957858718 3:85915201-85915223 AAGTAAAACTTCATGGAGGAAGG + Intronic
957962216 3:87271176-87271198 AGGAAGAGGTTCGTGGAAGAGGG + Intronic
958411343 3:93820315-93820337 ATGGAAAGCTTCAAGGAGGAAGG - Intergenic
960982953 3:123249137-123249159 ATGAAGAGGTACATAGGGGAAGG + Intronic
961841665 3:129719301-129719323 ATGTGGAGTTTCCTGGAGGGTGG + Intronic
962476761 3:135761758-135761780 AGGTAGAGGTACCAGGAGGAAGG + Intergenic
963693463 3:148535056-148535078 CTGTAGAGTTGGATGGAGGAGGG + Intergenic
964123587 3:153212020-153212042 AACTAGAGCTTCATGGAGAAAGG + Intergenic
965588656 3:170342178-170342200 ATGTACAGGATCATGGAACATGG - Intergenic
965784555 3:172322167-172322189 ATCTAGAGTTTCAGCGAGGAGGG + Intronic
966285149 3:178286712-178286734 ATGTGGAGGTTCCTGGAGGGTGG + Intergenic
966757360 3:183384038-183384060 ATGTGGAGGTTCAGGAATGAAGG - Intronic
967060249 3:185865947-185865969 GTGTAGAGTTTCCAGGAGGAGGG + Intergenic
967259270 3:187626000-187626022 ACGTAGAGGTCCCTGGAGGGTGG + Intergenic
967265494 3:187687673-187687695 ATGTGGAGGTTCCTGGAGAGTGG + Intergenic
967594603 3:191314838-191314860 ACGTGGAGGTTTCTGGAGGATGG + Intronic
968265407 3:197359113-197359135 ATGGAGAGGTTCACGCAGTAAGG + Intergenic
1202737319 3_GL000221v1_random:18194-18216 AGGTGGAGGGACATGGAGGAAGG - Intergenic
968627509 4:1633800-1633822 ATGTATATGTTCTTGGAGAATGG - Intronic
969241706 4:5902998-5903020 ATGCAGAGGCCCAGGGAGGAAGG - Intronic
969305958 4:6326454-6326476 AAGGAGAACTTCATGGAGGAGGG + Intronic
970456521 4:16227918-16227940 ATAGAGAATTTCATGGAGGATGG - Intergenic
970587848 4:17531398-17531420 ATGTGGAGGTTCCTGGAGGGAGG + Intergenic
970899777 4:21145320-21145342 ATTCAGAGTTTCATGGAGGTGGG + Intronic
971514470 4:27469145-27469167 ACGTAGAGGTTCCTGGAGGGTGG + Intergenic
972766980 4:42160137-42160159 ACGTGGAGGTTCCTGGAGGGTGG - Intergenic
972988199 4:44791753-44791775 ATGTAGGGGTTCAGTCAGGATGG + Intergenic
972991784 4:44829502-44829524 AGGTAGAGGTTATTAGAGGAGGG + Intergenic
973384760 4:49499690-49499712 AGGTGGAGGGACATGGAGGAAGG + Intergenic
973786934 4:54341330-54341352 AACTAGAGGATCATGGCGGATGG + Intergenic
975202696 4:71609884-71609906 ATGCAGAGGTTCCTGGAGGGTGG + Intergenic
976445418 4:85125629-85125651 ATGTAGGGGTTCAGTCAGGATGG - Intergenic
977148693 4:93480890-93480912 CTGTAGAGATTCAGGGAGGTGGG - Intronic
977572028 4:98638651-98638673 ATGTGGAGGTTCCTGTAGGGTGG - Intronic
977716010 4:100184756-100184778 ACTTGGAGGTTCCTGGAGGATGG - Intergenic
978445156 4:108773163-108773185 ATGTGGAGGTTCCTGAAGGCTGG + Intergenic
979327161 4:119393674-119393696 ATTTGCAGGTTGATGGAGGAAGG - Intergenic
980922791 4:139103534-139103556 ATGTGGAGGTTCCTGGAGTGTGG + Intronic
981254470 4:142645284-142645306 ATGTAGAGGTTCTCTTAGGATGG + Intronic
981483808 4:145263881-145263903 ATGTGTAGGTTCATGGAGGGTGG - Intergenic
981623769 4:146734301-146734323 ACGTGGAGTTTCCTGGAGGATGG + Intronic
981847275 4:149184029-149184051 ACGTAGAGGTGCGGGGAGGATGG + Intergenic
982588317 4:157271552-157271574 ATGTGGAGGTTTCTGGAGGGTGG - Intronic
983233141 4:165149883-165149905 ATGAAGAGGTCACTGGAGGAAGG - Intronic
983709886 4:170700921-170700943 ATGTAGCTGTTCCTGGAAGAAGG - Intergenic
983966880 4:173823420-173823442 ATGCAGAGGCTCTGGGAGGACGG + Intergenic
984763188 4:183379599-183379621 ATGTGGAGGTCCCTGGAGGGTGG + Intergenic
985430218 4:189871973-189871995 ACGTGGAGGTTCGTAGAGGAGGG - Intergenic
1202768615 4_GL000008v2_random:175022-175044 AGGTGGAGGGACATGGAGGAAGG + Intergenic
986128795 5:4908453-4908475 TTGTAGAGGTTCATGCTGAATGG + Intergenic
986790869 5:11158518-11158540 ATGTAGATATTCGTGGAGGCAGG + Intronic
988890345 5:35609768-35609790 ATGTAGAGTTTCCTGGATGGTGG + Intergenic
989381117 5:40810407-40810429 ATGTGGAGGTTCCTGGGGGGTGG - Intergenic
989624247 5:43414383-43414405 ATGTGGAGGTTCTTAGAGGGTGG + Intergenic
990129540 5:52564270-52564292 TTATAGGGGTTCATGGTGGAAGG + Intergenic
990305913 5:54493867-54493889 ACGTGGAGGTTCCTGGAGGGTGG + Intergenic
990393884 5:55355837-55355859 ATGTAGAGAGTCAGGGAAGAAGG + Intronic
990429994 5:55725309-55725331 ATGTAGAGGTTCCTGGAGGGTGG - Intronic
990473686 5:56141604-56141626 ATGTGGAGGTTTCTGGAGGGTGG + Intronic
990688985 5:58340918-58340940 ATGTTGAGGTTCAGGGTAGAAGG + Intergenic
991665513 5:68995772-68995794 TTTTAGAGGTTCATGGAAAAAGG - Intergenic
991902675 5:71476358-71476380 ATGAAGAGATTCATAGAGTACGG + Intronic
992129238 5:73674852-73674874 ACGTGGAGGTTCCTGGAGGGTGG + Intronic
992212327 5:74493073-74493095 CTGTGGAGGTTCTTGGAGGATGG - Intergenic
993189825 5:84668274-84668296 AACTGGAGGTTCATGGAGGGTGG + Intergenic
993523477 5:88934785-88934807 ATGTGTAGGTTCATGAGGGAAGG + Intergenic
993810554 5:92470779-92470801 ATGTGGAAGTTCCTGGAGGGTGG - Intergenic
994242226 5:97437328-97437350 ATTTAGAAGTTCATTGAGTAAGG - Intergenic
994379934 5:99058717-99058739 TTGTAGAGGTTGTGGGAGGAAGG + Intergenic
995539624 5:113171861-113171883 ATGTAGGGGCTCATGTAGTAGGG - Intronic
996503024 5:124237887-124237909 TTGCAGGGGTACATGGAGGAGGG - Intergenic
997080004 5:130726844-130726866 ATGTGGAGATTCCTGGAGGGTGG + Intergenic
997635491 5:135400974-135400996 CTGTAGAGGGGCATGGAGGTGGG - Intergenic
998329307 5:141309787-141309809 ACATGGAGGTTCTTGGAGGATGG - Intergenic
998754318 5:145359355-145359377 AGGGAGAGATTAATGGAGGATGG - Intergenic
998798135 5:145840435-145840457 ATATGGAGATTCCTGGAGGATGG + Intergenic
999153473 5:149442038-149442060 ATGTCAAGGTTCATAGAGGCTGG - Intergenic
1000040411 5:157480818-157480840 ATGTGGAGGTTCCTGGAGGAGGG + Exonic
1000193563 5:158936970-158936992 AAAGAGAGGGTCATGGAGGAGGG + Intronic
1000335021 5:160235687-160235709 CTGGAGAGCTTCAGGGAGGAGGG - Intronic
1000894179 5:166835200-166835222 ATATAGAGGGTGAGGGAGGAGGG + Intergenic
1001467718 5:171983239-171983261 AGGTGGAGGTTCCTGGAGGGTGG + Intronic
1001655303 5:173344639-173344661 AGGGTGAGGTGCATGGAGGATGG - Intergenic
1002209540 5:177589005-177589027 ATGTAGAGGTTCAGTCAGGATGG - Intergenic
1004040595 6:11971140-11971162 ATGTGGAGGTTCCTGGAAGATGG - Intergenic
1004112692 6:12735186-12735208 ATGGAGAGGCTCATGTAGCAAGG - Intronic
1004278237 6:14256949-14256971 ATGTGGAGGTTCCTGGAGGGTGG - Intergenic
1004355589 6:14927624-14927646 ATGTACAGGTTCCTGTAGGTTGG - Intergenic
1005152853 6:22772604-22772626 ACGTGGAGGTTACTGGAGGATGG + Intergenic
1005604923 6:27467168-27467190 TAGGAGAGTTTCATGGAGGATGG - Intronic
1005614781 6:27561860-27561882 ATGTGGAGGTTTCTGGAGGGTGG - Intergenic
1006002490 6:30976304-30976326 ATATGGAGGTTCCTGGAGGATGG - Intergenic
1006691945 6:35895910-35895932 AAGTAGAGATTCCTGGAGGGTGG + Intronic
1009374236 6:62947708-62947730 ATGTGGAGATTCCTGGAGGGTGG + Intergenic
1009436228 6:63621309-63621331 ATGTGGAGGTGCTTGGAAGATGG - Intergenic
1009623047 6:66100380-66100402 ATGTGCAGGTTCCTGGAGGAAGG - Intergenic
1009927282 6:70135198-70135220 GTTTAGAGGTTCCTGGAGGGTGG - Intronic
1010175244 6:73020463-73020485 ATCTGGAGGTTCCTGAAGGATGG - Intronic
1010521441 6:76843091-76843113 ATATAGAGAATAATGGAGGAGGG + Intergenic
1010631094 6:78199350-78199372 ATGTAGAGGGTCAGGGTGGGCGG - Intergenic
1011047275 6:83098697-83098719 ATGCGGAGGTTCCTGGAGGGTGG - Intronic
1011337202 6:86274699-86274721 ACATGGAGGTTCCTGGAGGATGG + Intergenic
1011848851 6:91601080-91601102 ATGTGGAGGTTCCTGGAGGGTGG + Intergenic
1012319279 6:97822902-97822924 AAGGAGAGTTTCATGGAGGGAGG + Intergenic
1013604753 6:111737570-111737592 ATGTGCAGGTTCCTGGAGGGTGG - Intronic
1014096555 6:117467973-117467995 ATGTGGAGGTTCCTGAAGGGCGG - Intronic
1014228999 6:118881321-118881343 ATGGAAAGTTTCAAGGAGGAAGG - Intronic
1015349103 6:132195892-132195914 ATGTGCAGGTAAATGGAGGAAGG - Intergenic
1015394372 6:132718273-132718295 ATGAAGAGGTGCATAGAGCAAGG + Intergenic
1015593360 6:134843404-134843426 ATGTGGAGGTTCCTGCAGGGTGG + Intergenic
1015705247 6:136080857-136080879 ATGGAGAGCTGCATGGAGGAAGG + Intronic
1018340940 6:162850628-162850650 ATGTGTAGGTTCCTGGAGGGTGG + Intronic
1018857014 6:167682024-167682046 ATGCAGAAGTTCATGGAAGCTGG + Intergenic
1019320699 7:414186-414208 AGGGAGAGGATCAAGGAGGAGGG - Intergenic
1019320733 7:414264-414286 AGGGAGAGGATCAAGGAGGAGGG - Intergenic
1019862059 7:3668383-3668405 ATGGAGAGGTCCATGTAGAAAGG - Intronic
1021292990 7:18868909-18868931 ATGTAGAGGTTCCTGGAGGGTGG + Intronic
1021991668 7:26147296-26147318 ATGTAGAGGCTCATGTGGCAAGG - Intergenic
1022665613 7:32407463-32407485 AGGAAGAGGATCATGGGGGAAGG - Intergenic
1023069812 7:36418155-36418177 ACGTGGAGGTTCCTGGAGGGTGG - Intronic
1023392239 7:39721432-39721454 ATGTGGAGGTTCCTGGAGGGCGG - Intergenic
1023416224 7:39935508-39935530 TTGCAGAGGTTCAGGGAGGAAGG - Intergenic
1023465132 7:40446076-40446098 ATGCAGAGGTTCCTGAAGGATGG - Intronic
1023919775 7:44619074-44619096 ATGTGGAGATTCCTGGAGGGTGG + Intronic
1025280500 7:57623614-57623636 TTTTAGAGGTTTAAGGAGGAAGG - Intergenic
1025304231 7:57841893-57841915 TTTTAGAGGTTTAAGGAGGAAGG + Intergenic
1025988064 7:66473520-66473542 ATAGAGAATTTCATGGAGGATGG + Intergenic
1027211049 7:76149417-76149439 ATAGAGAATTTCATGGAGGATGG + Intergenic
1027355142 7:77347084-77347106 AGGTGGAGGTTCCTGGAGGGTGG + Intronic
1028192451 7:87868717-87868739 ATGTTGAGGTTCCTGCAGGGTGG - Intronic
1028404471 7:90460878-90460900 ATGTGGAGGTTCCTGGAGGGTGG - Intronic
1029036677 7:97529562-97529584 ACGTGGAGATTCATGGAGGGTGG - Intergenic
1029050280 7:97679770-97679792 ATGTGGAGGTTCTTGGAGAGTGG + Intergenic
1029542222 7:101190548-101190570 ATGTGGAGGTTCTTGGAGGGTGG - Intergenic
1029812556 7:103064206-103064228 AGGTATAGGGTCATGGGGGAGGG - Intronic
1031304060 7:120101914-120101936 AGGTGGAGGTTCCTGGAGGATGG - Intergenic
1032539680 7:132692813-132692835 AGGCAGAGGATCAGGGAGGATGG - Intronic
1034232120 7:149538733-149538755 ATGAAGAGGTACATGGAGCAAGG + Intergenic
1034933914 7:155186121-155186143 ATCTAGAGCTCCATGGAGAAAGG - Intergenic
1035080570 7:156212631-156212653 ATGCAGATTTTCATGGAGGTAGG + Intergenic
1036660960 8:10708366-10708388 ATGGAGAGGTCCATGTGGGAGGG - Intronic
1037189261 8:16101555-16101577 ATGTGGAGGTTCCTGGAGGGTGG - Intergenic
1037264689 8:17045584-17045606 ATGTTGAGGTTCCTGGAGGGTGG + Intronic
1037573092 8:20175211-20175233 ATGGAGATGTTCAGGGAGCAAGG - Intronic
1037695200 8:21217458-21217480 ATGTGGAGGTTCCTGGAGAGGGG - Intergenic
1037988141 8:23302376-23302398 AGGGAGGGCTTCATGGAGGAAGG - Intronic
1038896339 8:31786803-31786825 ATACAGAGTTTCCTGGAGGACGG - Intronic
1038915553 8:32017772-32017794 GTGTGGAGGTTCCTGGAGGGTGG - Intronic
1039087999 8:33799044-33799066 AAGGAGAAGGTCATGGAGGAGGG + Intergenic
1039858596 8:41437307-41437329 ATGTTCATATTCATGGAGGAAGG - Intergenic
1041730001 8:61053426-61053448 ATGTAGTGTTTCAAGGAGGAGGG + Intergenic
1042149598 8:65767703-65767725 ATGTAGAGTTTCTTGGAGGGTGG + Intronic
1042321289 8:67478222-67478244 ACATGGAGGTTCATGGAGGGTGG + Intronic
1042369736 8:67977811-67977833 ATGTAGAGTTTCCTGGAGGGTGG + Intronic
1042502625 8:69525897-69525919 CTTTAGAGGTTGTTGGAGGAGGG + Intronic
1043946578 8:86260759-86260781 AGGTGGAGGTTGATGGGGGAGGG - Intronic
1044082997 8:87908140-87908162 ATGTGGAGGTTCCTGGAGGGAGG - Intergenic
1044100827 8:88136026-88136048 ATGTAGAGGCACATGGAAAAAGG + Intronic
1044123661 8:88430327-88430349 ATGTAAAGATTTATGGAGAATGG + Intergenic
1044124565 8:88441201-88441223 ATGAAGAGGTACATAGAGCAAGG - Intergenic
1044606729 8:94054327-94054349 ACGTGGAGGTTCCTGGAGGGTGG - Intergenic
1044697640 8:94938693-94938715 ATGTGGAGGTTCCCGGAGGGTGG + Intronic
1044711726 8:95064999-95065021 ATGTGGAGGTTCCTGGAGGGTGG + Intronic
1045331896 8:101162350-101162372 ACGTGGAGGTTCGTGGAGGGTGG + Intergenic
1046316334 8:112507817-112507839 TAGCAGAGGTGCATGGAGGAAGG - Intronic
1046319735 8:112557410-112557432 ATGAAGTTGTTCCTGGAGGATGG + Intronic
1047771402 8:128032962-128032984 CTGCAGAGGTGCATGGTGGAGGG + Intergenic
1048619435 8:136115470-136115492 ATATAGTGGGTCTTGGAGGATGG + Intergenic
1049163234 8:141111078-141111100 ATGTGTAGGGTCAGGGAGGACGG + Intergenic
1049701119 8:144013205-144013227 AGAAAGAGGGTCATGGAGGAGGG - Intronic
1050865981 9:10499926-10499948 AAGCAGAGATTCCTGGAGGATGG + Intronic
1052182397 9:25545822-25545844 AAGTGGAGGTTCCTGGAGGGTGG - Intergenic
1052759793 9:32578553-32578575 ATATGGAGGTTCCTGGAGGGTGG + Intergenic
1053278753 9:36802813-36802835 ATGAAAAGGATCAGGGAGGAGGG + Intergenic
1053660088 9:40267877-40267899 AGGTGGAGGGACATGGAGGAAGG - Intronic
1053910462 9:42897232-42897254 AGGTGGAGGGACATGGAGGAAGG - Intergenic
1054361085 9:64120583-64120605 AGGTGGAGGGACATGGAGGAAGG - Intergenic
1054372221 9:64414181-64414203 AGGTGGAGGGACATGGAGGAAGG - Intergenic
1054524510 9:66108340-66108362 AGGTGGAGGGACATGGAGGAAGG + Intronic
1054679839 9:67903878-67903900 AGGTGGAGGGACATGGAGGAAGG - Intergenic
1054794591 9:69288582-69288604 ATGCGGAGGTGCCTGGAGGATGG - Intergenic
1055250161 9:74294041-74294063 ATGTAGAGGTTGCTGGAGGGTGG - Intergenic
1055523625 9:77107974-77107996 ACGTGGAGGTTCTTGGAGGGTGG + Intergenic
1056203214 9:84296254-84296276 AGGTAGAGGTTGCTGGGGGAGGG + Intronic
1056662979 9:88558313-88558335 ACGTAGAGATTCCTGGAGGGTGG + Intronic
1057171153 9:92963975-92963997 GTGTAGATCTTCAGGGAGGAGGG - Intronic
1057336184 9:94156938-94156960 ATGAAGAGGCTCATGCACGATGG + Intergenic
1057392031 9:94648204-94648226 ACGTAGAGGTTCAGGAAGGCAGG - Intergenic
1057544648 9:96008614-96008636 ATGTGAAGTTTCATTGAGGAAGG - Intronic
1057550152 9:96046476-96046498 ACGAAGGGGTTCCTGGAGGATGG + Intergenic
1058551811 9:106122939-106122961 GTGTTGAGGTTCCTGGAGGTTGG + Intergenic
1060052511 9:120387298-120387320 AGGTAGAGGTCCTTGGGGGAAGG + Intergenic
1060934822 9:127508750-127508772 AAGGAGAGCTTCCTGGAGGAAGG + Intronic
1061853550 9:133429442-133429464 ATGGAGGGGTGGATGGAGGAGGG - Intronic
1203693510 Un_GL000214v1:68881-68903 AGGTGGAGGGACATGGAGGAAGG + Intergenic
1203464971 Un_GL000220v1:77320-77342 TTGCAGAGGATGATGGAGGAAGG - Intergenic
1203706042 Un_KI270742v1:48644-48666 AGGTGGAGGGACATGGAGGAAGG - Intergenic
1203557962 Un_KI270744v1:17248-17270 AGGTGGAGGGACATGGAGGAAGG + Intergenic
1203631871 Un_KI270750v1:78398-78420 TTTTAGAGGTTTAAGGAGGAAGG - Intergenic
1203642763 Un_KI270751v1:35182-35204 AGGTGGAGGGACATGGAGGAAGG - Intergenic
1185524917 X:770241-770263 CTGAACTGGTTCATGGAGGAGGG + Intergenic
1185956329 X:4495073-4495095 ATGTGGCTGTTCATGGAGGCAGG - Intergenic
1186334648 X:8573408-8573430 ATGTTAAGGATCATGGAGCATGG - Intronic
1186808288 X:13161882-13161904 ACGTAGAGGTTCCTGGAGGGTGG - Intergenic
1187300330 X:18042896-18042918 AATTAAAGGTTCAGGGAGGAGGG + Intergenic
1187937011 X:24345950-24345972 ATGTACAGGATCATGGGGCATGG - Intergenic
1188890514 X:35606321-35606343 ATGTGGAGGTTCCTGGAGAGTGG + Intergenic
1189312399 X:40028901-40028923 ACGTGGAGGTTCCTGGAGGGTGG + Intergenic
1189592911 X:42534458-42534480 ATGAAGAGGTTCATGTGGCAAGG + Intergenic
1189646911 X:43143047-43143069 ATGTGGTGGTTCAAGGAGAAAGG - Intergenic
1189876112 X:45437961-45437983 AGGGAGAGGTCCCTGGAGGAAGG - Intergenic
1190589152 X:51980128-51980150 ATTTAGAGGTTCCTGGAGCATGG - Intergenic
1190702598 X:52999714-52999736 AGGTAGAGGTCCGTGGTGGAAGG - Intergenic
1191689578 X:63926067-63926089 GTGTAGGGGTTAATGGAAGAGGG + Intergenic
1191893460 X:65968468-65968490 ATGCAGAAGATCATGGAGAAGGG + Intergenic
1193753930 X:85383010-85383032 ATGTGGAGGTTCTTAGAGAATGG - Intergenic
1193844351 X:86450218-86450240 TTGTTGGGGGTCATGGAGGATGG - Intronic
1194819773 X:98491195-98491217 ATGTGGAGGTTCCTGGAGAGTGG + Intergenic
1195344157 X:103931984-103932006 ATATGGAGGTTCCTGGAGGGTGG + Intronic
1195362790 X:104101225-104101247 ATGTGGAGGTTCCTGGAGGGTGG - Exonic
1196218760 X:113087544-113087566 ATGAAGAAGATCATGGCGGATGG + Intergenic
1196654431 X:118202240-118202262 ATGGAGAGGTACATGTAGCAAGG - Intergenic
1196783742 X:119404518-119404540 ATGTGGAGGTTCCTGAAGGGTGG - Intronic
1196802056 X:119552555-119552577 ATGTGGAGGTTCCTGAAGGGTGG - Intronic
1197620733 X:128744598-128744620 ATGTAAATGCTCATGGATGATGG + Intergenic
1197884908 X:131208497-131208519 GTGTATAGGTTCATGCAGGTAGG + Intergenic
1198736644 X:139792741-139792763 ATGTAGGGGTTCCTGGAGGGTGG + Intronic
1198747301 X:139903473-139903495 ACGTGGAGGTTCCTGGAGGGTGG + Intronic
1199723155 X:150557676-150557698 ATGTGGAGGTTCCTGAAGGGTGG + Intergenic
1201471446 Y:14339848-14339870 ATCCAGATGTTCCTGGAGGAAGG + Intergenic