ID: 955543134

View in Genome Browser
Species Human (GRCh38)
Location 3:59999312-59999334
Sequence GATGGTGGTGCTGCACAAAA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 248
Summary {0: 1, 1: 0, 2: 1, 3: 18, 4: 228}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
955543134_955543138 4 Left 955543134 3:59999312-59999334 CCATTTTGTGCAGCACCACCATC 0: 1
1: 0
2: 1
3: 18
4: 228
Right 955543138 3:59999339-59999361 AAGTTAATGGAATTACCGTGTGG 0: 1
1: 0
2: 2
3: 4
4: 67
955543134_955543139 18 Left 955543134 3:59999312-59999334 CCATTTTGTGCAGCACCACCATC 0: 1
1: 0
2: 1
3: 18
4: 228
Right 955543139 3:59999353-59999375 ACCGTGTGGTCACGCACTAGAGG 0: 1
1: 0
2: 0
3: 0
4: 19
955543134_955543142 29 Left 955543134 3:59999312-59999334 CCATTTTGTGCAGCACCACCATC 0: 1
1: 0
2: 1
3: 18
4: 228
Right 955543142 3:59999364-59999386 ACGCACTAGAGGGAACCTATTGG 0: 1
1: 0
2: 0
3: 1
4: 33
955543134_955543135 -9 Left 955543134 3:59999312-59999334 CCATTTTGTGCAGCACCACCATC 0: 1
1: 0
2: 1
3: 18
4: 228
Right 955543135 3:59999326-59999348 ACCACCATCGTTAAAGTTAATGG 0: 1
1: 0
2: 0
3: 6
4: 54
955543134_955543141 19 Left 955543134 3:59999312-59999334 CCATTTTGTGCAGCACCACCATC 0: 1
1: 0
2: 1
3: 18
4: 228
Right 955543141 3:59999354-59999376 CCGTGTGGTCACGCACTAGAGGG 0: 1
1: 0
2: 0
3: 1
4: 27

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
955543134 Original CRISPR GATGGTGGTGCTGCACAAAA TGG (reversed) Intronic
900913144 1:5616501-5616523 GAGGGTGGAGCTGCACAAGTGGG + Intergenic
904388919 1:30166535-30166557 GAAGAGGGTGCTGCACAGAAAGG + Intergenic
905444464 1:38016988-38017010 GATGGTGGTGATGGATTAAATGG + Intronic
906815571 1:48874862-48874884 TAAGGTGGTGGTGCACAGAATGG - Intronic
907751568 1:57268296-57268318 GATGATGCTGCTGCAAAAGAAGG + Intronic
908084536 1:60616740-60616762 GATGGTGGTAAAGCAGAAAATGG + Intergenic
908453035 1:64274411-64274433 GATGGTGGTGGTGTACAGATGGG - Intergenic
912639712 1:111333229-111333251 GATGCTGGTCCTGCACAGCAGGG - Intergenic
912934747 1:113993448-113993470 GATGCTGGTCCTGCACAGCAGGG + Intergenic
912993125 1:114509244-114509266 GATTGTGGAGCTGCACTAAAGGG - Intronic
913438977 1:118877215-118877237 GCTGGTGGTGCTCCTCAGAAAGG - Intergenic
913475516 1:119233199-119233221 GAGGATGGAGCTGCACAAACAGG + Intergenic
913719299 1:121575274-121575296 GATGATGGTGATGTACAGAAGGG - Intergenic
914338561 1:146739031-146739053 GATGGTGGTGCTGTAAGCAATGG + Intergenic
915786902 1:158623602-158623624 GAAAGAAGTGCTGCACAAAAGGG - Intronic
915814732 1:158953592-158953614 GATGATGGTGATGTACAGAAGGG - Intronic
918517947 1:185383748-185383770 GATGATGGTGATGTACAGAAGGG + Intergenic
918826407 1:189330418-189330440 GATGATGGTGATGTACAAAAGGG + Intergenic
919528322 1:198681496-198681518 GATAGTGTTGCTGAACAAATAGG + Intronic
920142196 1:203824690-203824712 GGTGGTGGTGCTGCTTAAAATGG + Intronic
920889425 1:209969380-209969402 GCTGGTGAGGCTGCAGAAAAAGG - Intronic
921496864 1:215853063-215853085 TATGTTGGGGCAGCACAAAAGGG - Intronic
921547206 1:216486495-216486517 GATGGTGGTGATGTACAGATGGG - Intergenic
922206124 1:223447846-223447868 GATGATGGTGATGTACAAATAGG - Intergenic
922824326 1:228506667-228506689 GATGGTGGTGATGTACAGATGGG - Intergenic
923966230 1:239142020-239142042 GAAAGTGGTGCTGCAGATAAAGG + Intergenic
924142091 1:241035700-241035722 GGTGGTGGTGCTGGAGATAATGG - Intronic
924474573 1:244371771-244371793 CAAGGTGGTGCTTCAGAAAATGG + Intronic
924911577 1:248519236-248519258 GATGATGGTGATGTACAGAAGGG + Intergenic
924912524 1:248528804-248528826 GATGATGGTGATGTACAGAAGGG - Intergenic
1063332912 10:5180124-5180146 GATGATGGTGATGCACAGATGGG + Intergenic
1065328357 10:24569824-24569846 AATGGTGAGGCTGCCCAAAAGGG + Intergenic
1066595294 10:37043903-37043925 GATGATGGTGATGTACAAATGGG + Intergenic
1067138233 10:43630906-43630928 GACGGTGGTTCTGGCCAAAAGGG - Intergenic
1067418945 10:46130433-46130455 GATGGTGGTGCTGGAGATACTGG - Intergenic
1068547875 10:58371938-58371960 GATGGTTGTGTTGCACAAATAGG + Intergenic
1071854589 10:89610685-89610707 TATGTTAGTTCTGCACAAAATGG + Intronic
1072842251 10:98788095-98788117 GATGGTGGTGATGTACAGATGGG + Intronic
1073042291 10:100615766-100615788 GGTGGGGGTGCTGCAAGAAAGGG + Intergenic
1073923667 10:108488019-108488041 GGTGGTGGTGGTGGAGAAAATGG + Intergenic
1077830630 11:5866150-5866172 GCTGGTGAGGCTGCAGAAAAAGG + Intronic
1077923641 11:6659552-6659574 GGTGGTGGTCCTGCACAAACTGG + Intergenic
1078090823 11:8263341-8263363 GATGATGGTGCTGGACAAGGAGG - Exonic
1079304271 11:19308632-19308654 GATGCTGGCCCTGCACAAAGAGG + Intergenic
1082629109 11:55520359-55520381 GATGATGGTGATGCACAGATAGG + Intergenic
1083464511 11:62836027-62836049 GATGAGGGTGCTGCAGAGAAAGG + Exonic
1083802753 11:65056266-65056288 GGTGGTGATGTTGCACAATATGG - Intronic
1084737013 11:71111983-71112005 GATGGTGGGGATGCACCACATGG + Intronic
1084796868 11:71512017-71512039 GATGATGGTGATGTACAGAAGGG - Intronic
1085474324 11:76780383-76780405 GATAGTGGTGCGGCCCAGAAAGG - Intergenic
1089033598 11:115360639-115360661 GATTGTGCTGATGCACAGAAAGG + Intronic
1090723312 11:129497129-129497151 GATGGTGCTGCCTCATAAAATGG - Intergenic
1090879739 11:130823174-130823196 GAGGGTGGTGCTGGAGAACACGG + Intergenic
1091067822 11:132533225-132533247 GATGGTGGTGTTTTACAATAGGG + Intronic
1091255282 11:134178732-134178754 GATGATGGTGCTGCAAAGAAGGG + Exonic
1091424519 12:375730-375752 GATGATGGTGATGTACAAATGGG + Intronic
1092194358 12:6540405-6540427 GAGGGTGGGGCTGCACAGAGGGG - Exonic
1092535098 12:9379609-9379631 GTTGGTGGAGCTGAACACAAGGG + Intergenic
1092949656 12:13489642-13489664 GATGGGGATGCTGCAGAAATAGG - Intergenic
1095065128 12:37762684-37762706 GATGTTGGTGATGCACAGATGGG - Intergenic
1095092294 12:38118588-38118610 GATGGTGGTGGTGATGAAAATGG + Intergenic
1095647852 12:44570279-44570301 GATGCTGGTGCTCCACAATTAGG + Intronic
1098586027 12:72155542-72155564 GATGATGGTGATGTACAAATGGG + Intronic
1098675808 12:73288807-73288829 GATGGTGGTGATGTACAGATGGG + Intergenic
1099000990 12:77178541-77178563 GATGGTGGTGATGTACAGATGGG + Intergenic
1099511418 12:83543560-83543582 GCTGCTGCTGCTGCATAAAAAGG - Intergenic
1099548131 12:84011058-84011080 GATGATGGTGATGCACAGATGGG + Intergenic
1100709697 12:97242559-97242581 GATGGTTATGATGAACAAAAGGG - Intergenic
1100720635 12:97354554-97354576 GATGATGGTGATGTACAGAAGGG + Intergenic
1101105755 12:101438233-101438255 GCTGTTGATGCTGCTCAAAAAGG - Intergenic
1102727812 12:115081015-115081037 GATGGTGGTGATGAAGAAAGAGG + Intergenic
1104189802 12:126469327-126469349 GATGGTGCTTCTGAATAAAATGG - Intergenic
1104351449 12:128047675-128047697 GATGGTGGTGATGAAGATAATGG - Intergenic
1106241884 13:27919779-27919801 GCTGGCGGTGCTCCCCAAAATGG - Intergenic
1111616291 13:90664839-90664861 GATGGTGGTGATGTACAGATGGG - Intergenic
1116038442 14:39656861-39656883 GATGGTGGTGATGTACAAATGGG - Intergenic
1116292680 14:43063189-43063211 GATGATGGTGATGTACAGAAGGG - Intergenic
1120589202 14:86355456-86355478 GATGGTGGTGCTGAATAAAATGG + Intergenic
1122095099 14:99364693-99364715 GATGGTGGTGGTGGCCATAATGG - Intergenic
1124714852 15:32050796-32050818 GATGATGGTGATGCACAGATGGG + Intronic
1126066139 15:44827690-44827712 GAGGGTGGAGCTGCAGAACATGG + Intergenic
1126093697 15:45072874-45072896 GAGGGTGGAGCTGCAGAACATGG - Intronic
1132254771 15:100366122-100366144 GATGATGGTGATGTACAAATGGG - Intergenic
1132261345 15:100427621-100427643 GATGTTTGTGCAGCACACAAGGG - Intronic
1133588851 16:7222959-7222981 GATGTTTATGCTGCACAACAAGG - Intronic
1134123355 16:11599961-11599983 GATGGTAGTGCAACAGAAAAAGG - Intronic
1136882088 16:33908267-33908289 GCTGGTGGGGCTGCAAAAGAGGG + Intergenic
1137347952 16:47682914-47682936 GATGATGGTGATGTACAGAAGGG + Intronic
1139995718 16:70978323-70978345 GATGGTGGTGCTGTAAGCAATGG - Intronic
1141823619 16:86464156-86464178 GATGGTGGTGGTGGTGAAAATGG + Intergenic
1203089922 16_KI270728v1_random:1207179-1207201 GCTGGTGGGGCTGCAAAAGAGGG - Intergenic
1146565969 17:33913043-33913065 GCTGGAAGTGCTGCTCAAAAAGG - Intronic
1146569541 17:33940836-33940858 GATGGTGGTGATGCACTGTAGGG + Intronic
1146794531 17:35772057-35772079 GATGGGGGTGCTAGACTAAAAGG + Intronic
1148675805 17:49444247-49444269 GCTGGTGGAGCTGCAGTAAAGGG + Intronic
1153494705 18:5685522-5685544 GATGATGGTGCTGTACAGATGGG - Intergenic
1154160996 18:11981096-11981118 GAGGGTGATGCTGCACCACAGGG + Intronic
1155699517 18:28726151-28726173 GATGGCAGTGCTGCACCAGAAGG + Intergenic
1155977282 18:32144453-32144475 GTTGGTGCTGCTGAACAAATAGG - Intronic
1156521227 18:37723887-37723909 GATGCTGCTGCTGCATAAACAGG + Intergenic
1157141447 18:45111169-45111191 GTTGCTGATGCTCCACAAAATGG - Intergenic
1159549935 18:69884314-69884336 GATGTTGGTGTTCCACAGAATGG + Intronic
1163050343 19:14678589-14678611 GATGGTGGTGATGCCAATAATGG + Intronic
1163377893 19:16944889-16944911 GCTGTTGGTGCGGCACCAAATGG + Intronic
1164603571 19:29579818-29579840 GATGGTGCTGCTGCCCTAAATGG - Intergenic
1165002526 19:32776712-32776734 GGTGGTGGTGCTGGACAGGATGG - Intronic
1167325584 19:48822854-48822876 GATGGTGGTGATGGTGAAAATGG + Intronic
1168322742 19:55519703-55519725 GATGGTGGTGCTGGTCATGAGGG + Intergenic
925013316 2:502857-502879 GATGGTATTTCAGCACAAAATGG + Intergenic
926613507 2:14971583-14971605 GATGGTGGTGGTGGAAGAAAAGG - Intergenic
926829036 2:16940170-16940192 GATGGTGGAGCTGAAGAAAGAGG - Intergenic
926924491 2:17973422-17973444 GGTAGTGTTGGTGCACAAAAGGG + Intronic
926977919 2:18533480-18533502 GGTCATGGTGGTGCACAAAAAGG + Intergenic
928889707 2:36189320-36189342 GATGCTGCTGCTTTACAAAAGGG - Intergenic
929438749 2:41948975-41948997 GATGGTGGTGATTCCCACAATGG + Intronic
930893792 2:56422019-56422041 GATGATGGTGATGTACAAATGGG - Intergenic
932686694 2:73876556-73876578 GATGGTGGTGATGGGGAAAAAGG - Intergenic
932984287 2:76707231-76707253 GATGGTGGTGATGTACAGACGGG + Intergenic
932991778 2:76796651-76796673 GATGATGGTGATGCACAGATGGG - Intronic
933709794 2:85316449-85316471 GATGGCGCTGCTGCACAGCAGGG - Intergenic
933713269 2:85343314-85343336 GATGGCGCTGCTGCACAGCAGGG + Exonic
933893909 2:86793565-86793587 GCTGGTGGTGCTGAGCAAAATGG - Intronic
935421959 2:102879176-102879198 GATGGTGGTGATGTACAGATGGG + Intergenic
936576129 2:113656996-113657018 GATGATGGTGATGTACAGAAGGG - Intergenic
936700429 2:115005209-115005231 GATGATGGTGATGTACAGAAGGG - Intronic
938273965 2:129999481-129999503 GATGATGGTGATGTACAGAAGGG - Intergenic
938442247 2:131346649-131346671 GATGATGGTGATGTACAGAAGGG + Intronic
941532477 2:166686773-166686795 GATGATGGTGATGTACAAACTGG - Intergenic
941606223 2:167600510-167600532 GATGGTGGAGCGGTACCAAAGGG - Intergenic
943140563 2:183976413-183976435 GATGGTGGTGATGTACAGATGGG - Intergenic
943310044 2:186313751-186313773 GATGATGGTGATGCACAGATGGG - Intergenic
944709555 2:202323585-202323607 GATGGTTTTGCTTTACAAAATGG + Intergenic
947002964 2:225478299-225478321 GATGGTGCAGCTGCATAAACAGG + Intronic
948449965 2:238063153-238063175 GATGATGATGCTGCCCAGAAAGG + Intronic
1172690434 20:36785967-36785989 GATGGTGATGATGCCCAACAGGG + Exonic
1174054629 20:47789257-47789279 GATGGCTGTTCTGCACAAAAGGG - Intergenic
1174166632 20:48588114-48588136 GATGATGGTGATGTACAGAAGGG - Intergenic
1176170164 20:63693150-63693172 TATGGTGGGGCCGCACAAACTGG - Exonic
1177083462 21:16671982-16672004 GATGGTGATTGTGGACAAAATGG - Intergenic
1177608658 21:23416868-23416890 GATGCTGTTGCTGCCTAAAAGGG + Intergenic
1180519572 22:16184569-16184591 GATGATGGTGATGTACAAATGGG - Intergenic
1184374014 22:44100231-44100253 GATGTTGGTGCTGCATGAGAAGG + Intronic
950213919 3:11144056-11144078 GATGGTAGGGATGCAGAAAAAGG + Intronic
955430072 3:58834024-58834046 GATGGTGGGGCTGGAGGAAAGGG + Intronic
955543134 3:59999312-59999334 GATGGTGGTGCTGCACAAAATGG - Intronic
956262497 3:67360251-67360273 GATGGAGGTGCTGAACAATAAGG + Intergenic
956690925 3:71877026-71877048 GATGGGGGTGCTGTAGGAAAGGG + Intergenic
960208398 3:114930835-114930857 GATGATGTTGCAGCAGAAAAGGG + Intronic
960238876 3:115317466-115317488 GATGATGGTGATGCACAGATGGG + Intergenic
963484504 3:145918879-145918901 GATGGTGGTGATGTACAGATGGG - Intergenic
963512730 3:146269019-146269041 GAGGGTGGAGCTGCACAAATGGG + Intergenic
965975640 3:174617709-174617731 ATTTGTGGTGCTGCATAAAATGG + Intronic
967186776 3:186950575-186950597 GATGGAGGGGCTTCACAAAATGG + Intronic
969218519 4:5743492-5743514 GATGGTGGTGCTGATGAAGATGG - Intronic
970166759 4:13246631-13246653 GATGGTGGTACAACACATAAAGG - Intergenic
970825289 4:20265510-20265532 CAAGGTGGTATTGCACAAAAAGG - Intronic
971362960 4:25953724-25953746 GCTGGTGATGGTGCAGAAAAAGG + Intergenic
973292681 4:48484919-48484941 CATGATGATGCTGCAGAAAAGGG - Exonic
973311280 4:48712059-48712081 GATGATGGTGATGCACAGATGGG - Intronic
973347158 4:49068833-49068855 GATGATGGTGATGTACAGAAGGG - Intergenic
975092731 4:70423059-70423081 GATGATGGTGATGTACAGAAGGG + Intergenic
975813574 4:78194922-78194944 GATGGTGGTGATGTACAGATGGG + Intronic
977063600 4:92286620-92286642 GGTGGTGATGCAGCATAAAAGGG - Intergenic
978022517 4:103831599-103831621 GATGATGGTGATGTACAGAAGGG + Intergenic
978729391 4:112007308-112007330 GATGCTGGTGGATCACAAAATGG + Intergenic
978761475 4:112358946-112358968 TGTGGTGGGGCTGCACAAACTGG - Intronic
981360111 4:143836414-143836436 GATGTTGGTGTGGAACAAAATGG + Intergenic
982517296 4:156368126-156368148 GATGGTGGTGATGTACAGATGGG - Intergenic
982946056 4:161624963-161624985 GCTGTTGATGCTGGACAAAATGG - Intronic
984383902 4:179030927-179030949 GATGGTGGTGATGTACAGATGGG - Intergenic
987184069 5:15397107-15397129 GATGATGGTGATGTACAGAAGGG - Intergenic
988685009 5:33517650-33517672 GAAGCTGGGGCTGCACAAAATGG - Intergenic
989216866 5:38913848-38913870 GAAGGAGGTGTTACACAAAAAGG + Intronic
989793140 5:45431796-45431818 TATGGTGGCGCTACAAAAAAAGG - Intronic
990541863 5:56781475-56781497 GATGGTGGTGATGTACAGATGGG + Intergenic
991402014 5:66262010-66262032 GATGATGGTGCTGTACAGATGGG + Intergenic
993168744 5:84388311-84388333 GGTTGTGGTGGTGCACAAAAGGG + Intergenic
994662690 5:102672078-102672100 GATGATGGTGATGTACAAATGGG - Intergenic
995923646 5:117343407-117343429 GATGGTGGTGATGTACAGATGGG + Intergenic
996121929 5:119682020-119682042 TCTGGTGGTTCTGAACAAAAGGG + Intergenic
996130882 5:119779914-119779936 GATGATGGTGATGTACAAATGGG + Intergenic
996231145 5:121065093-121065115 GATGGTGGTGATGTACAGATGGG - Intergenic
998335199 5:141365447-141365469 GATGGTGATTCTGGAGAAAATGG + Exonic
999025913 5:148231455-148231477 GATGATGGTGATGTACAAATGGG - Intergenic
999120187 5:149203566-149203588 GATGGTGGTGTTGTTCATAATGG - Intronic
1001379303 5:171293019-171293041 GAGGGTGGGGATGCACACAAAGG - Intronic
1002269652 5:178062145-178062167 GATGGCAGTGTTGCACACAATGG - Intergenic
1002456728 5:179349575-179349597 GATGAGGGGGCTGGACAAAATGG - Intergenic
1007768650 6:44176617-44176639 GATGCAGCTGCTGCACAAGACGG + Exonic
1008375525 6:50787039-50787061 GTATGTGGTGCTGAACAAAATGG + Intergenic
1010854491 6:80821073-80821095 GATGATGGTGATGTACAAATGGG - Intergenic
1011004874 6:82633094-82633116 GATGATGGTGATGTACAAATGGG - Intergenic
1011533619 6:88351799-88351821 GATGATGGTGATGTACAAATGGG - Intergenic
1012388021 6:98703911-98703933 GATGGTGGTGATGTACAGATGGG - Intergenic
1012434975 6:99205266-99205288 GATGATGGTGATGTACAAATGGG - Intergenic
1013886596 6:114975527-114975549 GATGGTGGTGATGTACAGATGGG + Intergenic
1013908980 6:115251064-115251086 GATGGTGGTGATGTACAGATGGG - Intergenic
1014871245 6:126598973-126598995 GATGATGGTGATGTACAGAAGGG + Intergenic
1019314010 7:376317-376339 GATGGGGGAGCTGCAGAACAGGG + Intergenic
1020349320 7:7201154-7201176 GATGATGGTGACGTACAAAATGG + Intronic
1026089519 7:67287760-67287782 GGTGGTGGTGCCGCAGGAAAGGG - Intergenic
1026724766 7:72862744-72862766 GGTGGTGGTGCCGCAGGAAAGGG + Intergenic
1027119114 7:75503076-75503098 GGTGGTGGTGCTGCAGGAAAGGG - Intergenic
1027272713 7:76532529-76532551 GGTGGTGGTGCCGCAGGAAAGGG + Intergenic
1027326162 7:77051614-77051636 GGTGGTGGTGCCGCAGGAAAGGG + Intergenic
1027896718 7:84054854-84054876 GATGATGGTGATGCACAGATGGG + Intronic
1028773896 7:94657453-94657475 GATGGTGCTGGTAGACAAAATGG + Intronic
1029325338 7:99802769-99802791 GATGGTGGTGATGTACAGATGGG + Intergenic
1029718383 7:102346956-102346978 GGTGGTGGTGCCGCAGGAAAGGG + Intergenic
1029754233 7:102562299-102562321 GGTGGTGGTGCCGCAGGAAAGGG - Intronic
1029772183 7:102661389-102661411 GGTGGTGGTGCCGCAGGAAAGGG - Intronic
1030255969 7:107508888-107508910 GATGTTGGTGATGTACAGAAGGG - Intronic
1031523620 7:122797205-122797227 GATGGTGATGTTGCAGAAAAAGG + Intronic
1031687083 7:124744315-124744337 CATGGTGGTGCTTCAGGAAATGG - Intergenic
1033713029 7:143968977-143968999 GATGGTGGTGTTTCACACCAGGG - Intergenic
1034755334 7:153612413-153612435 GGTGGTGGTGGTTCAAAAAATGG + Intergenic
1036468978 8:9033085-9033107 GTTGGTGGTGCAGAACAAAGAGG - Exonic
1041573651 8:59367945-59367967 GATGGTAGGGCTCCACCAAAGGG - Intergenic
1043135797 8:76522712-76522734 GGTGGTGGTGGTGCTCAAAGAGG - Intergenic
1044042388 8:87386104-87386126 GATGATGGTGATGCACAGATGGG - Intronic
1045360363 8:101426737-101426759 GATGATGGTGATGCACAGATGGG - Intergenic
1047517360 8:125566788-125566810 GATGGTGGTGCAGTGCAAAAGGG + Intergenic
1048379912 8:133856382-133856404 GATGGTGGTGGTACAAAAATTGG + Intergenic
1050143080 9:2537142-2537164 GGTGCTGGGGCTGCACAAGATGG + Intergenic
1050649141 9:7756335-7756357 AATGGTGGTGCTGTTTAAAATGG - Intergenic
1051299119 9:15629022-15629044 GATGATGGTGATGTACAGAAGGG - Intronic
1051386439 9:16514135-16514157 GCTGGTGGTGCTTCACTGAAGGG - Intronic
1051537738 9:18178868-18178890 GATGATGGTGATGTACAAATGGG - Intergenic
1052814106 9:33086405-33086427 GATGGTGGTGATGTACAGATGGG - Intergenic
1056769395 9:89465928-89465950 GAAGGTGATGCTGCAGAATAAGG + Intronic
1058207975 9:102131793-102131815 GATGGTGGTGATGTACAGATGGG - Intergenic
1060882720 9:127129638-127129660 GGTGCTGGTGCTGGACAACAGGG + Intronic
1189170916 X:38908576-38908598 GATGTTGGTGCTGGAAGAAATGG - Intergenic
1189356197 X:40311645-40311667 GGTGGTGGTGCTGTAGAACAAGG + Intergenic
1189551409 X:42097344-42097366 GATGGTGGAGAAGCACAAAGGGG + Intergenic
1189934884 X:46057506-46057528 GATGATGGTGATGTACAAATGGG + Intergenic
1190301817 X:49061451-49061473 GCTGGTGATGCTGCTGAAAATGG + Intronic
1191808636 X:65162917-65162939 GATGATGGTGATGCACACATGGG + Intergenic
1193950964 X:87797704-87797726 GAGAATGGTGCTGCAAAAAAGGG + Intergenic
1194814841 X:98429481-98429503 GATGATGGTGATGTACAAATGGG + Intergenic
1195275357 X:103275976-103275998 GAAGGAGGTGCTGTAGAAAAAGG - Intronic
1197112324 X:122790929-122790951 GATGGAGGTGATGGAGAAAATGG - Intergenic
1197240938 X:124122709-124122731 GAGGGTGGTGTTGAAGAAAAAGG + Intronic
1197617683 X:128713226-128713248 AATGGTGCTGCTGCAGAGAAGGG + Intergenic
1197676734 X:129337896-129337918 GATGATGGTGATGTACAAATGGG - Intergenic
1198619059 X:138486900-138486922 GATGGTGGAGCTACAGAACAGGG + Intergenic
1201466164 Y:14283142-14283164 GATGATGGTGATGTACAAATGGG - Intergenic
1202095172 Y:21242331-21242353 GATGCTGGAGCTGCTCAACATGG - Intergenic