ID: 955545443

View in Genome Browser
Species Human (GRCh38)
Location 3:60023739-60023761
Sequence CTAGTTGAGCCTATCTATAA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 65
Summary {0: 1, 1: 0, 2: 0, 3: 5, 4: 59}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
955545443_955545447 16 Left 955545443 3:60023739-60023761 CCTTTATAGATAGGCTCAACTAG 0: 1
1: 0
2: 0
3: 5
4: 59
Right 955545447 3:60023778-60023800 CACAGAGCTTAACATAGCATTGG 0: 1
1: 0
2: 3
3: 76
4: 2652

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
955545443 Original CRISPR CTAGTTGAGCCTATCTATAA AGG (reversed) Intronic
903847357 1:26286254-26286276 CTTATCAAGCCTATCTATAAAGG + Intronic
907746282 1:57216916-57216938 CTACTAGAGCCTCTCTAGAAAGG - Intronic
911807678 1:102232529-102232551 CTAGTTGAGGTCAGCTATAAGGG + Intergenic
912696545 1:111846511-111846533 GTAGTTGAGCCTATGGACAATGG + Intronic
1063395923 10:5687335-5687357 CTAGTTAAGGATATCTATATAGG - Intronic
1065216468 10:23453982-23454004 CCAGTTGAAACTATCAATAAAGG - Intergenic
1069719962 10:70543680-70543702 CCAGTTGACCATATGTATAAGGG + Intronic
1074906892 10:117872469-117872491 ATATTTGAGCCTATCTTTATAGG + Intergenic
1091203409 11:133800352-133800374 CTAGATGAGGATATCTTTAAAGG + Intergenic
1106809135 13:33342322-33342344 CTGGTTGGGCCTACGTATAATGG - Intronic
1107563240 13:41576573-41576595 CAAGTTCAGCATATCTATAATGG - Intronic
1109386906 13:61642144-61642166 CAAGATGAGCCAATCTATAAAGG - Intergenic
1111525081 13:89458023-89458045 CTAGTTGAGCTGATTTCTAAGGG - Intergenic
1114928700 14:27439091-27439113 CTAGTTAAGCATTTTTATAAAGG - Intergenic
1117581652 14:57157488-57157510 AAAGTTGAGCCTATCTAGATAGG - Intergenic
1117712081 14:58541293-58541315 CTAGTGGAGCACATCTTTAATGG + Intronic
1121892058 14:97603556-97603578 CTAGATGAGCTTATCTGTAAAGG - Intergenic
1127823307 15:62679976-62679998 CTAGTTCAGCACATCTATATGGG + Intronic
1144393099 17:14814227-14814249 CTAATTGAGACTCTCTATTATGG + Intergenic
1150925302 17:69526329-69526351 CCACTTAAGCCTATCTAAAATGG - Intronic
1157024027 18:43821407-43821429 CTAGTTGTCCATATATATAACGG - Intergenic
1162758047 19:12872204-12872226 CTAGCTCCTCCTATCTATAAGGG - Intronic
937271874 2:120658108-120658130 CAAGTTGAGCCCATCCATATTGG - Intergenic
939644806 2:144684693-144684715 TTAATTGAGCCTATCAAGAAAGG + Intergenic
940402863 2:153267333-153267355 CTAGTAGAGGTTTTCTATAAGGG + Intergenic
945182779 2:207108786-207108808 CCAGTTGAGGATATTTATAATGG - Intronic
947197501 2:227583530-227583552 CTAGTAGAGCCTCTCTGTGAGGG - Intergenic
1170767439 20:19302287-19302309 GTACTTGATACTATCTATAATGG + Intronic
1183555737 22:38525393-38525415 CTTGTTTAGGTTATCTATAATGG - Intronic
951833144 3:26952231-26952253 CTACTTGAGTCCATCTATTAAGG - Intergenic
955545443 3:60023739-60023761 CTAGTTGAGCCTATCTATAAAGG - Intronic
967319760 3:188183924-188183946 CTAGTTCAGTCTATCTCTATGGG - Intronic
967559493 3:190901625-190901647 CTAGTAGAGCTTCTCCATAAGGG - Intergenic
972416606 4:38847105-38847127 ATAGATGAGCATCTCTATAAAGG + Intronic
977735933 4:100415451-100415473 TTAATTGAGCCTCTCCATAAAGG - Intronic
980219435 4:129896631-129896653 CTAGTTAAGCCTTTTGATAATGG + Intergenic
980383556 4:132058398-132058420 CTAGTTGAGCTTCTCTATGAGGG - Intergenic
982790867 4:159589924-159589946 ATAATAGAGCCTATCTAGAAAGG + Intergenic
986811650 5:11366025-11366047 CTAGTTCAGCCTCTCTATTCCGG + Intronic
987466146 5:18274615-18274637 CTAGTTGATGATATCTATCAAGG + Intergenic
988074772 5:26338611-26338633 CTAGTAGAGGCTCTCTATGAGGG + Intergenic
1007403545 6:41618598-41618620 CTAGTGCAGCCTATCTGCAACGG + Intergenic
1007649345 6:43408495-43408517 CTATATGAGCCTCTCCATAAGGG - Intergenic
1012022454 6:93941731-93941753 ATAGTAGAGCATATCTATCAAGG - Intergenic
1018502140 6:164422634-164422656 CTAGTAGAGGTTCTCTATAAGGG - Intergenic
1018575760 6:165258675-165258697 CTAGTAGAGGCTCTTTATAAGGG + Intergenic
1020571853 7:9873246-9873268 CTAGTTGAACCTTTCTATTAGGG - Intergenic
1022606336 7:31818247-31818269 GTAGTTGTACCTTTCTATAAAGG - Intronic
1024501506 7:50113119-50113141 CTAGTTAAGCCTGACTACAAAGG - Intronic
1027666498 7:81047343-81047365 CTAGTTGAGTTTATCCATGAGGG - Intergenic
1027953680 7:84852921-84852943 TTAGTTTAGCCTAACTAGAAAGG - Intergenic
1030502174 7:110373324-110373346 ATATTTGAGCCTTTCCATAAAGG + Intergenic
1042984214 8:74565594-74565616 CTTGTGGAGCCTGTGTATAAAGG + Intergenic
1045413176 8:101940431-101940453 CATGTTGAGGCTATCTAAAATGG - Intronic
1047531605 8:125681908-125681930 ATAGTTGAACCTACCTATCATGG - Intergenic
1052044377 9:23777417-23777439 CTAGTTGAGAATCACTATAAGGG + Intronic
1056259561 9:84834306-84834328 CTATTTAATCCTACCTATAAAGG + Intronic
1059187076 9:112284063-112284085 CTAGTAGAGCTTCTCTATGAGGG - Intronic
1193251716 X:79298836-79298858 CTAGTAGAGCCCAGCAATAAGGG + Intergenic
1193627328 X:83837387-83837409 CTAGTAGAGCTTCTCTGTAAAGG + Intergenic
1194397233 X:93401651-93401673 CTAGTTGAGTCTCTCTGTGAAGG - Intergenic
1194598820 X:95894330-95894352 CTATTGAAGCCTCTCTATAATGG - Intergenic
1201266057 Y:12207889-12207911 CCATTTGAGCATATCTAGAAGGG - Intergenic
1201517404 Y:14833007-14833029 CTAGGTGAGCCCATCTCTTATGG - Intronic
1201935837 Y:19410098-19410120 CTAGTAGAGGTTCTCTATAAGGG - Intergenic